|
Data courtesy of Kevin Glenn, M.D., Carver College of Medicine at the University of Iowa
A complimentary approach to overexpression experiments is to observe the effects of F-Box Protein 6 (i.e. FBG2 or FBXO6) specific suppression on A1AT levels. A panel of FBG2 specific shRNA plasmids (MISSION™ TRC Target Set NM_018438, see Table 1) was transfected into COS-7 cells in equimolar amounts with a FLAG-tagged FBG2 expression plasmid.
Note: A1AT is also known as serpin peptidase inhibitor, clade A (alpha-1antiproteinase, antitrypsin), member 1 (SERPINA1).
Table 1. MISSION™ TRC Target Set NM_018438
| TRC Clone Number |
Target Region |
Sequence |
| TRCN0000007731 |
3UTR |
CCGGTGTGGTAACTTACTGTCACATCTCGAGATGTGACAGTAAGTTACCACATTTTT |
| TRCN0000007732 |
CDS |
CCGGGCATGGCAAATTGATTTCAATCTCGAGATTGAAATCAATTTGCCATGCTTTTT |
| TRCN0000007733 |
CDS |
CCGGTGTGCTGAAGAGGATATGTTTCTCGAGAAACATATCCTCTTCAGCACATTTTT |
| TRCN0000007734 |
CDS |
CCGGCCTACGAAATGTGCCTCAAGTCTCGAGACTTGAGGCACATTTCGTAGGTTTTT |
Total cell lysates were prepared and probed via Western blotting using Anti-FLAG™ and anti-tubulin antibodies. Compared to shRNA-7731 (a negative control shRNA that is targeted to the 3’ UTR), shRNA-7732 achieved significant suppression, while shRNAs-7733 and -7734 achieved modest suppression (Figure 1). This proof of principle experiment demonstrates that shRNAs are likely to be effective in suppressing FBG2 expression.
Figure 1. Western blot of COS-7 cell lysates from co-transfections of FLAG-FBG2 and MISSION™ TRC shRNA plasmids. Total cell lysates were probed with indicated antibodies.
3’ UTR shRNA constructs not only serve a role as ideal negative controls in overexpression experiments. They also are pertinent to cDNA rescue experiments. In studies where the endogenous protein is knocked down via stable shRNA expression, the phenotype may be rescued by expression of cDNA constructs. 3’UTR hairpins will not target the exogenous copy of the protein. Thus, the phenotype of the cell may be rescued validating that the effect seen is in fact due to targeted gene silencing.
Send this page to a colleague.
Contact Us
For questions about the library, pricing and quotes or other concerns, please e-mail us at: RNAi@sial.com.
MISSION is a registered trademark of Sigma-Aldrich Biotechnology LP and Sigma-Aldrich Co. Label License.
back to top
back to Application Data
shRNA Homepage
RNAi Homepage
|