EMAIL THIS PAGE TO A FRIEND

A1BG

alpha-1-B glycoprotein

Synonyms: A1B ABG GAB HYST2477
UniProtKB ID: P04217, A8K052, Q68CK0, Q8IYJ6, Q96P39
Gene ID:
Human(1) Summary: The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins. [provided by RefSeq, Jul 2008]
Mouse(117586) alpha-1-B glycoprotein
Rat(140656) alpha-1-B glycoprotein
cow(518955) alpha-1-B glycoprotein
domestic cat(101089972) alpha-1-B glycoprotein
naked mole-rat(101702400) alpha-1-B glycoprotein
domestic guinea pig(100729341) alpha-1-B glycoprotein
sheep(101119665) alpha-1-B glycoprotein
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_128290 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128290 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128290 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU178311 MISSION® esiRNA esiRNA targeting mouse A1bg mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_130786 Rosetta Predictions human pricing
NM_022258 Rosetta Predictions rat pricing
NM_001081067 Rosetta Predictions mouse pricing
XM_128290 Rosetta Predictions mouse pricing
XM_979604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096504 predicted 1125
2 SASI_Hs01_00096505 predicted 1124
3 SASI_Hs01_00096509 predicted 953
4 SASI_Hs01_00096510 predicted 1353
5 SASI_Hs02_00362819 predicted 1175
6 SASI_Hs01_00096512 predicted 1449
7 SASI_Hs02_00362820 predicted 1369
8 SASI_Hs02_00362821 predicted 380
9 SASI_Hs02_00362822 predicted 653
10 SASI_Hs02_00362823 predicted 1694
11 SASI_Hs01_00096506 predicted 830
12 SASI_Hs01_00096507 predicted 829
13 SASI_Hs01_00096508 predicted 631
14 SASI_Hs01_00096511 predicted 880
15 SASI_Hs01_00096513 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022258 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109390 predicted 859
2 SASI_Rn02_00263048 predicted 1104
3 SASI_Rn02_00263049 predicted 653
4 SASI_Rn02_00263050 predicted 387
5 SASI_Rn01_00109392 predicted 278
6 SASI_Rn01_00109394 predicted 959
7 SASI_Rn01_00109396 predicted 873
8 SASI_Rn02_00263051 predicted 846
9 SASI_Rn01_00109397 predicted 1124
10 SASI_Rn02_00263052 predicted 373
11 SASI_Rn01_00109391 predicted 1159
12 SASI_Rn01_00109393 predicted 1256
13 SASI_Rn01_00109395 predicted 1317
14 SASI_Rn01_00109398 predicted 1326
15 SASI_Rn01_00109399 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294851 predicted 958
2 SASI_Mm02_00294852 predicted 1091
3 SASI_Mm02_00294853 predicted 840
4 SASI_Mm02_00294854 predicted 1176
5 SASI_Mm02_00294855 predicted 263
6 SASI_Mm02_00294856 predicted 908
7 SASI_Mm02_00294857 predicted 597
8 SASI_Mm02_00294858 predicted 1525
9 SASI_Mm02_00294859 predicted 745
10 SASI_Mm02_00294860 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274685 predicted 961
2 SASI_Mm01_00274686 predicted 1096
3 SASI_Mm01_00274687 predicted 844
4 SASI_Mm01_00274688 predicted 1181
5 SASI_Mm01_00274689 predicted 271
6 SASI_Mm01_00274690 predicted 1427
7 SASI_Mm01_00274691 predicted 912
8 SASI_Mm01_00274692 predicted 597
9 SASI_Mm01_00274693 predicted 1529
10 SASI_Mm01_00274694 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235163 predicted 1346
2 SASI_Mm01_00235164 predicted 1173
3 SASI_Mm01_00235165 predicted 1120
4 SASI_Mm01_00235166 predicted 1179
5 SASI_Mm01_00235167 predicted 1284
6 SASI_Mm01_00235168 predicted 1298
7 SASI_Mm01_00235169 predicted 1052
8 SASI_Mm01_00235170 predicted 1008
9 SASI_Mm01_00235171 predicted 1307
10 SASI_Mm01_00235172 predicted 1126
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130786
VALIDATED
A1BG MISSION shRNA Bacterial Glycerol Stock
alpha-1-B glycoprotein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130786.2-2290s1c1
Sequence:CCGGGCCTCTTTCATCTGTGCTCTTCTCGAGAAGAGCACAGATGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130786.2-1126s1c1
Sequence:CCGGCTCTTCGAGCTGCACAACATTCTCGAGAATGTTGTGCAGCTCGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130786.2-679s1c1
Sequence:CCGGCCGCCTGTGCTGATGCACCATCTCGAGATGGTGCATCAGCACAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130786.2-154s1c1
Sequence:CCGGGAGTCCGAATCACTGCTGAAACTCGAGTTTCAGCAGTGATTCGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_130786.2-104s1c1
Sequence:CCGGCAGTGACAGAAGCAGCCATATCTCGAGATATGGCTGCTTCTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130786
VALIDATED
A1BG MISSION shRNA shRNA Plasmid DNA
alpha-1-B glycoprotein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130786.2-2290s1c1
Sequence:CCGGGCCTCTTTCATCTGTGCTCTTCTCGAGAAGAGCACAGATGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130786.2-1126s1c1
Sequence:CCGGCTCTTCGAGCTGCACAACATTCTCGAGAATGTTGTGCAGCTCGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130786.2-679s1c1
Sequence:CCGGCCGCCTGTGCTGATGCACCATCTCGAGATGGTGCATCAGCACAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130786.2-154s1c1
Sequence:CCGGGAGTCCGAATCACTGCTGAAACTCGAGTTTCAGCAGTGATTCGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_130786.2-104s1c1
Sequence:CCGGCAGTGACAGAAGCAGCCATATCTCGAGATATGGCTGCTTCTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130786
VALIDATED
A1BG MISSION shRNA Lentiviral Transduction Particles
alpha-1-B glycoprotein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130786.2-2290s1c1
Sequence:CCGGGCCTCTTTCATCTGTGCTCTTCTCGAGAAGAGCACAGATGAAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130786.2-1126s1c1
Sequence:CCGGCTCTTCGAGCTGCACAACATTCTCGAGAATGTTGTGCAGCTCGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130786.2-679s1c1
Sequence:CCGGCCGCCTGTGCTGATGCACCATCTCGAGATGGTGCATCAGCACAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130786.2-154s1c1
Sequence:CCGGGAGTCCGAATCACTGCTGAAACTCGAGTTTCAGCAGTGATTCGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_130786.2-104s1c1
Sequence:CCGGCAGTGACAGAAGCAGCCATATCTCGAGATATGGCTGCTTCTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128290
A1BG MISSION shRNA Bacterial Glycerol Stock
alpha-1-B glycoprotein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128290.4-1412s1c1
Sequence:CCGGGCTGAGTCAATGAAGCCATTTCTCGAGAAATGGCTTCATTGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128290.4-1162s1c1
Sequence:CCGGCACAAGAAGCACCTCAGCTTACTCGAGTAAGCTGAGGTGCTTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128290.4-845s1c1
Sequence:CCGGCCGGAATTAGTTGTGGTGCAACTCGAGTTGCACCACAACTAATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128290.4-695s1c1
Sequence:CCGGGTAGAGTTAATGTGGAGTGATCTCGAGATCACTCCACATTAACTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128290.4-1280s1c1
Sequence:CCGGCCTGTGGAGGTTATAGTAGAACTCGAGTTCTACTATAACCTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128290
A1BG MISSION shRNA shRNA Plasmid DNA
alpha-1-B glycoprotein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128290.4-1412s1c1
Sequence:CCGGGCTGAGTCAATGAAGCCATTTCTCGAGAAATGGCTTCATTGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128290.4-1162s1c1
Sequence:CCGGCACAAGAAGCACCTCAGCTTACTCGAGTAAGCTGAGGTGCTTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128290.4-845s1c1
Sequence:CCGGCCGGAATTAGTTGTGGTGCAACTCGAGTTGCACCACAACTAATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128290.4-695s1c1
Sequence:CCGGGTAGAGTTAATGTGGAGTGATCTCGAGATCACTCCACATTAACTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128290.4-1280s1c1
Sequence:CCGGCCTGTGGAGGTTATAGTAGAACTCGAGTTCTACTATAACCTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128290
A1BG MISSION shRNA Lentiviral Transduction Particles
alpha-1-B glycoprotein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089078    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128290.4-1412s1c1
Sequence:CCGGGCTGAGTCAATGAAGCCATTTCTCGAGAAATGGCTTCATTGACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128290.4-1162s1c1
Sequence:CCGGCACAAGAAGCACCTCAGCTTACTCGAGTAAGCTGAGGTGCTTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128290.4-845s1c1
Sequence:CCGGCCGGAATTAGTTGTGGTGCAACTCGAGTTGCACCACAACTAATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128290.4-695s1c1
Sequence:CCGGGTAGAGTTAATGTGGAGTGATCTCGAGATCACTCCACATTAACTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128290.4-1280s1c1
Sequence:CCGGCCTGTGGAGGTTATAGTAGAACTCGAGTTCTACTATAACCTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks