EMAIL THIS PAGE TO A FRIEND

A2M

alpha-2-macroglobulin

80 Gene Product Result for
Synonyms: A2MD CPAMD5 FWP007 S863-7
Gene ID:
Human(2) Summary: Alpha-2-macroglobulin is a protease inhibitor and cytokine transporter. It inhibits many proteases, including trypsin, thrombin and collagenase. A2M is implicated in Alzheimer disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. [provided by RefSeq, Jul 2008]
Mouse(232345) alpha-2-macroglobulin
Rat(24153) alpha-2-macroglobulin
chicken(418251) alpha-2-macroglobulin
dog(477699) alpha-2-macroglobulin
cow(513856) alpha-2-macroglobulin
Horse(100061656) alpha-2-macroglobulin
domestic cat(101080460) alpha-2-macroglobulin
naked mole-rat(101704340) alpha-2-macroglobulin
sheep(101122940) alpha-2-macroglobulin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0600 Human A2M / Alpha-2-macroglobulin ELISA Kit human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0449 AQUA Peptide SFQLEGGL[K] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000014 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000014 Rosetta Predictions human pricing
NM_012488 Rosetta Predictions rat pricing
NM_175628 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109672 predicted 582
2 SASI_Hs01_00109674 predicted 1346
3 SASI_Hs02_00301661 predicted 4414
4 SASI_Hs01_00109676 predicted 1329
5 SASI_Hs02_00301662 predicted 2535
6 SASI_Hs02_00301663 predicted 266
7 SASI_Hs02_00301664 predicted 3331
8 SASI_Hs01_00109681 predicted 3166
9 SASI_Hs02_00301665 predicted 1241
10 SASI_Hs02_00301666 predicted 3137
11 SASI_Hs01_00109673 predicted 1516
12 SASI_Hs01_00109675 predicted 3603
13 SASI_Hs01_00109677 predicted 2145
14 SASI_Hs01_00109678 predicted 743
15 SASI_Hs01_00109679 predicted 3302
16 SASI_Hs01_00109680 predicted 3912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116871 predicted 1959
2 SASI_Rn01_00116872 predicted 3906
3 SASI_Rn02_00259512 predicted 3260
4 SASI_Rn02_00259513 predicted 2835
5 SASI_Rn01_00116874 predicted 1737
6 SASI_Rn01_00116875 predicted 1594
7 SASI_Rn02_00259514 predicted 3491
8 SASI_Rn01_00116876 predicted 3495
9 SASI_Rn01_00116878 predicted 1993
10 SASI_Rn02_00259515 predicted 1176
11 SASI_Rn01_00116869 predicted 2670
12 SASI_Rn01_00116870 predicted 358
13 SASI_Rn01_00116873 predicted 2765
14 SASI_Rn01_00116877 predicted 1738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111690 predicted 3460
2 SASI_Mm01_00111691 predicted 2237
3 SASI_Mm01_00111693 predicted 2194
4 SASI_Mm02_00346554 predicted 2739
5 SASI_Mm01_00111695 predicted 3908
6 SASI_Mm01_00111696 predicted 3142
7 SASI_Mm01_00111697 predicted 2966
8 SASI_Mm01_00111698 predicted 1824
9 SASI_Mm02_00346555 predicted 2069
10 SASI_Mm01_00111699 predicted 3935
11 SASI_Mm01_00111692 predicted 4117
12 SASI_Mm01_00111694 predicted 3523
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000014
VALIDATED
A2M MISSION shRNA Bacterial Glycerol Stock
alpha-2-macroglobulin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-3407s21c1
Sequence:CCGGAGTGACCCTCTCCGCCTATATCTCGAGATATAGGCGGAGAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-1366s21c1
Sequence:CCGGCTCTTACTGTTAGGGTCAATTCTCGAGAATTGACCCTAACAGTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-2033s21c1
Sequence:CCGGAGACTGCATCAATCGTCATAACTCGAGTTATGACGATTGATGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-2148s21c1
Sequence:CCGGACCAACTCAAAGATTCGTAAACTCGAGTTTACGAATCTTTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-1238s21c1
Sequence:CCGGAGGCGTCCCTATACCAAATAACTCGAGTTATTTGGTATAGGGACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000014.3-1940s1c1
Sequence:CCGGCCTTTGAATGACCAGGACGATCTCGAGATCGTCCTGGTCATTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000014.3-722s1c1
Sequence:CCGGCCCAAGTTTGAAGTACAAGTACTCGAGTACTTGTACTTCAAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000014.3-4377s1c1
Sequence:CCGGCCATAGTGAAAGTCTATGATTCTCGAGAATCATAGACTTTCACTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_000014.3-2987s1c1
Sequence:CCGGCCTAACATCTATGTACTGGATCTCGAGATCCAGTACATAGATGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000014.3-1471s1c1
Sequence:CCGGCCAGGCACATTATATTCTGAACTCGAGTTCAGAATATAATGTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000014
VALIDATED
A2M MISSION shRNA shRNA Plasmid DNA
alpha-2-macroglobulin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-3407s21c1
Sequence:CCGGAGTGACCCTCTCCGCCTATATCTCGAGATATAGGCGGAGAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-1366s21c1
Sequence:CCGGCTCTTACTGTTAGGGTCAATTCTCGAGAATTGACCCTAACAGTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-2033s21c1
Sequence:CCGGAGACTGCATCAATCGTCATAACTCGAGTTATGACGATTGATGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-2148s21c1
Sequence:CCGGACCAACTCAAAGATTCGTAAACTCGAGTTTACGAATCTTTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-1238s21c1
Sequence:CCGGAGGCGTCCCTATACCAAATAACTCGAGTTATTTGGTATAGGGACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000014.3-1940s1c1
Sequence:CCGGCCTTTGAATGACCAGGACGATCTCGAGATCGTCCTGGTCATTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000014.3-722s1c1
Sequence:CCGGCCCAAGTTTGAAGTACAAGTACTCGAGTACTTGTACTTCAAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000014.3-4377s1c1
Sequence:CCGGCCATAGTGAAAGTCTATGATTCTCGAGAATCATAGACTTTCACTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_000014.3-2987s1c1
Sequence:CCGGCCTAACATCTATGTACTGGATCTCGAGATCCAGTACATAGATGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000014.3-1471s1c1
Sequence:CCGGCCAGGCACATTATATTCTGAACTCGAGTTCAGAATATAATGTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000014
VALIDATED
A2M MISSION shRNA Lentiviral Transduction Particles
alpha-2-macroglobulin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-3407s21c1
Sequence:CCGGAGTGACCCTCTCCGCCTATATCTCGAGATATAGGCGGAGAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-1366s21c1
Sequence:CCGGCTCTTACTGTTAGGGTCAATTCTCGAGAATTGACCCTAACAGTAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-2033s21c1
Sequence:CCGGAGACTGCATCAATCGTCATAACTCGAGTTATGACGATTGATGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-2148s21c1
Sequence:CCGGACCAACTCAAAGATTCGTAAACTCGAGTTTACGAATCTTTGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000014.4-1238s21c1
Sequence:CCGGAGGCGTCCCTATACCAAATAACTCGAGTTATTTGGTATAGGGACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000014.3-1940s1c1
Sequence:CCGGCCTTTGAATGACCAGGACGATCTCGAGATCGTCCTGGTCATTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000014.3-722s1c1
Sequence:CCGGCCCAAGTTTGAAGTACAAGTACTCGAGTACTTGTACTTCAAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000014.3-4377s1c1
Sequence:CCGGCCATAGTGAAAGTCTATGATTCTCGAGAATCATAGACTTTCACTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_000014.3-2987s1c1
Sequence:CCGGCCTAACATCTATGTACTGGATCTCGAGATCCAGTACATAGATGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000014.3-1471s1c1
Sequence:CCGGCCAGGCACATTATATTCTGAACTCGAGTTCAGAATATAATGTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175628
A2M MISSION shRNA Bacterial Glycerol Stock
alpha-2-macroglobulin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-1511s1c1
Sequence:CCGGCCAGGCTCATTATATTCTAAACTCGAGTTTAGAATATAATGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-4031s1c1
Sequence:CCGGCCTCCAGACATCCTTGAAATACTCGAGTATTTCAAGGATGTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-2093s1c1
Sequence:CCGGCCTAAAGGATATGGGCTTAAACTCGAGTTTAAGCCCATATCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-230s1c1
Sequence:CCGGCCTCCTGTTCAACCACCTAAACTCGAGTTTAGGTGGTTGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-3091s1c1
Sequence:CCGGCGGGTTACCAAAGACAATTAACTCGAGTTAATTGTCTTTGGTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175628
A2M MISSION shRNA shRNA Plasmid DNA
alpha-2-macroglobulin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-1511s1c1
Sequence:CCGGCCAGGCTCATTATATTCTAAACTCGAGTTTAGAATATAATGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-4031s1c1
Sequence:CCGGCCTCCAGACATCCTTGAAATACTCGAGTATTTCAAGGATGTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-2093s1c1
Sequence:CCGGCCTAAAGGATATGGGCTTAAACTCGAGTTTAAGCCCATATCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-230s1c1
Sequence:CCGGCCTCCTGTTCAACCACCTAAACTCGAGTTTAGGTGGTTGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-3091s1c1
Sequence:CCGGCGGGTTACCAAAGACAATTAACTCGAGTTAATTGTCTTTGGTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175628
A2M MISSION shRNA Lentiviral Transduction Particles
alpha-2-macroglobulin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-1511s1c1
Sequence:CCGGCCAGGCTCATTATATTCTAAACTCGAGTTTAGAATATAATGAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-4031s1c1
Sequence:CCGGCCTCCAGACATCCTTGAAATACTCGAGTATTTCAAGGATGTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-2093s1c1
Sequence:CCGGCCTAAAGGATATGGGCTTAAACTCGAGTTTAAGCCCATATCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-230s1c1
Sequence:CCGGCCTCCTGTTCAACCACCTAAACTCGAGTTTAGGTGGTTGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175628.2-3091s1c1
Sequence:CCGGCGGGTTACCAAAGACAATTAACTCGAGTTAATTGTCTTTGGTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks