EMAIL THIS PAGE TO A FRIEND

A2ML1

alpha-2-macroglobulin-like 1

72 Gene Product Result for
Synonyms: CPAMD9
Gene ID:
Human(144568) Summary: This gene encodes a member of the alpha-macroglobulin superfamily. The encoded protein acts as an inhibitor for several proteases, and has been reported as the p170 antigen recognized by autoantibodies in the autoimmune disease paraneoplastic pemphigus (PNP; PMID: 20805888). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Zebrafish(569025) alpha-2-macroglobulin-like 1
cow(516769) alpha-2-macroglobulin-like 1
domestic cat(101101643) alpha-2-macroglobulin-like 1
dog(486697) alpha-2-macroglobulin-like 1
chicken(418254) alpha-2-macroglobulin-like 1
sheep(101123200) alpha-2-macroglobulin-like 1
Domestic Rabbit(100347314) alpha-2-macroglobulin-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144670 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078161 MISSION® esiRNA esiRNA human A2ML1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144670 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215417 predicted 3875
2 SASI_Hs01_00215418 predicted 4008
3 SASI_Hs01_00215419 predicted 1968
4 SASI_Hs01_00215420 predicted 1558
5 SASI_Hs02_00364564 predicted 4417
6 SASI_Hs02_00364565 predicted 4525
7 SASI_Hs01_00215421 predicted 3932
8 SASI_Hs01_00215422 predicted 2670
9 SASI_Hs02_00364566 predicted 2425
10 SASI_Hs01_00215423 predicted 3569
11 SASI_Hs01_00215424 predicted 3503
12 SASI_Hs01_00215425 predicted 4291
13 SASI_Hs01_00215426 predicted 3910
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144670
A2ML1 MISSION shRNA Bacterial Glycerol Stock
alpha-2-macroglobulin-like 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144670.1-730s1c1
Sequence:CCGGCCCTTTCAAGACAGAAGCATTCTCGAGAATGCTTCTGTCTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144670.1-227s1c1
Sequence:CCGGCTCACTATTCACACCAGTTATCTCGAGATAACTGGTGTGAATAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144670.1-349s1c1
Sequence:CCGGCCTGGTGAAGAAGGTTGAATTCTCGAGAATTCAACCTTCTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144670.1-112s1c1
Sequence:CCGGGCAGACGGTGTTGAGATACAACTCGAGTTGTATCTCAACACCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144670.1-515s1c1
Sequence:CCGGGCAACAATTCAGTATTCTGATCTCGAGATCAGAATACTGAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144670.3-3937s21c1
Sequence:CCGGCAGTTAACAGATTGGTATTTCCTCGAGGAAATACCAATCTGTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144670
A2ML1 MISSION shRNA shRNA Plasmid DNA
alpha-2-macroglobulin-like 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144670.1-730s1c1
Sequence:CCGGCCCTTTCAAGACAGAAGCATTCTCGAGAATGCTTCTGTCTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144670.1-227s1c1
Sequence:CCGGCTCACTATTCACACCAGTTATCTCGAGATAACTGGTGTGAATAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144670.1-349s1c1
Sequence:CCGGCCTGGTGAAGAAGGTTGAATTCTCGAGAATTCAACCTTCTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144670.1-112s1c1
Sequence:CCGGGCAGACGGTGTTGAGATACAACTCGAGTTGTATCTCAACACCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144670.1-515s1c1
Sequence:CCGGGCAACAATTCAGTATTCTGATCTCGAGATCAGAATACTGAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144670.3-3937s21c1
Sequence:CCGGCAGTTAACAGATTGGTATTTCCTCGAGGAAATACCAATCTGTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144670
A2ML1 MISSION shRNA Lentiviral Transduction Particles
alpha-2-macroglobulin-like 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144670.1-730s1c1
Sequence:CCGGCCCTTTCAAGACAGAAGCATTCTCGAGAATGCTTCTGTCTTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144670.1-227s1c1
Sequence:CCGGCTCACTATTCACACCAGTTATCTCGAGATAACTGGTGTGAATAGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144670.1-349s1c1
Sequence:CCGGCCTGGTGAAGAAGGTTGAATTCTCGAGAATTCAACCTTCTTCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144670.1-112s1c1
Sequence:CCGGGCAGACGGTGTTGAGATACAACTCGAGTTGTATCTCAACACCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144670.1-515s1c1
Sequence:CCGGGCAACAATTCAGTATTCTGATCTCGAGATCAGAATACTGAATTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144670.3-3937s21c1
Sequence:CCGGCAGTTAACAGATTGGTATTTCCTCGAGGAAATACCAATCTGTTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks