EMAIL THIS PAGE TO A FRIEND

A3GALT2

alpha 1,3-galactosyltransferase 2

37 Gene Product Result for
Synonyms: A3GALT2P IGBS3S
Gene ID:
Mouse(215493) alpha 1,3-galactosyltransferase 2 (isoglobotriaosylceramide synthase)
Rat(171553) alpha 1,3-galactosyltransferase 2
cow(617693) alpha 1,3-galactosyltransferase 2
dog(487298) alpha 1,3-galactosyltransferase 2 (isoglobotriaosylceramide synthase)
domestic guinea pig(100725746) alpha 1,3-galactosyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001009819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001009819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001009819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080438 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080438 Rosetta Predictions human pricing
NM_138524 Rosetta Predictions rat pricing
NM_001009819 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314846 predicted 298
2 SASI_Hs02_00314847 predicted 569
3 SASI_Hs02_00314848 predicted 330
4 SASI_Hs02_00314849 predicted 709
5 SASI_Hs02_00314850 predicted 297
6 SASI_Hs02_00314851 predicted 398
7 SASI_Hs02_00314852 predicted 692
8 SASI_Hs02_00314853 predicted 230
9 SASI_Hs02_00314854 predicted 313
10 SASI_Hs02_00314855 predicted 272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113761 predicted 800
2 SASI_Rn01_00113762 predicted 1185
3 SASI_Rn01_00113763 predicted 1387
4 SASI_Rn01_00113765 predicted 1171
5 SASI_Rn01_00113766 predicted 1346
6 SASI_Rn01_00113767 predicted 260
7 SASI_Rn01_00113768 predicted 278
8 SASI_Rn01_00113769 predicted 979
9 SASI_Rn01_00113770 predicted 275
10 SASI_Rn02_00268144 predicted 424
11 SASI_Rn01_00113764 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009819 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165463 predicted 1469
2 SASI_Mm01_00165464 predicted 1842
3 SASI_Mm01_00165465 predicted 1314
4 SASI_Mm01_00165466 predicted 827
5 SASI_Mm02_00286869 predicted 887
6 SASI_Mm01_00165469 predicted 988
7 SASI_Mm01_00165470 predicted 799
8 SASI_Mm01_00165471 predicted 976
9 SASI_Mm01_00165472 predicted 1732
10 SASI_Mm02_00286870 predicted 813
11 SASI_Mm01_00165467 predicted 831
12 SASI_Mm01_00165468 predicted 821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009819
A3GALT2 MISSION shRNA Bacterial Glycerol Stock
alpha 1,3-galactosyltransferase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-821s1c1
Sequence:CCGGTGTCGTTAAGCGAAGGCGATTCTCGAGAATCGCCTTCGCTTAACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-329s1c1
Sequence:CCGGCAATTATTTGGGATGGCACTTCTCGAGAAGTGCCATCCCAAATAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-168s1c1
Sequence:CCGGCCTGTACCATTACAGGTTCATCTCGAGATGAACCTGTAATGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-183s1c1
Sequence:CCGGGTTCATTATTATCAGGCTCATCTCGAGATGAGCCTGATAATAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-957s1c1
Sequence:CCGGCGACGAAAGCCACCTTAACAACTCGAGTTGTTAAGGTGGCTTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009819
A3GALT2 MISSION shRNA shRNA Plasmid DNA
alpha 1,3-galactosyltransferase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-821s1c1
Sequence:CCGGTGTCGTTAAGCGAAGGCGATTCTCGAGAATCGCCTTCGCTTAACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-329s1c1
Sequence:CCGGCAATTATTTGGGATGGCACTTCTCGAGAAGTGCCATCCCAAATAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-168s1c1
Sequence:CCGGCCTGTACCATTACAGGTTCATCTCGAGATGAACCTGTAATGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-183s1c1
Sequence:CCGGGTTCATTATTATCAGGCTCATCTCGAGATGAGCCTGATAATAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-957s1c1
Sequence:CCGGCGACGAAAGCCACCTTAACAACTCGAGTTGTTAAGGTGGCTTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009819
A3GALT2 MISSION shRNA Lentiviral Transduction Particles
alpha 1,3-galactosyltransferase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-821s1c1
Sequence:CCGGTGTCGTTAAGCGAAGGCGATTCTCGAGAATCGCCTTCGCTTAACGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-329s1c1
Sequence:CCGGCAATTATTTGGGATGGCACTTCTCGAGAAGTGCCATCCCAAATAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-168s1c1
Sequence:CCGGCCTGTACCATTACAGGTTCATCTCGAGATGAACCTGTAATGGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-183s1c1
Sequence:CCGGGTTCATTATTATCAGGCTCATCTCGAGATGAGCCTGATAATAATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001009819.1-957s1c1
Sequence:CCGGCGACGAAAGCCACCTTAACAACTCGAGTTGTTAAGGTGGCTTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080438
A3GALT2 MISSION shRNA Bacterial Glycerol Stock
alpha 1,3-galactosyltransferase 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-84s21c1
Sequence:CCGGTCTGTATGGCCTCCCTAAATTCTCGAGAATTTAGGGAGGCCATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-401s21c1
Sequence:CCGGGCGTGATGTACTACGTGTTCACTCGAGTGAACACGTAGTACATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-305s21c1
Sequence:CCGGCCATTGGGCTGACTATCTTTGCTCGAGCAAAGATAGTCAGCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-56s21c1
Sequence:CCGGTACTTACACTTGGCCTCTTAGCTCGAGCTAAGAGGCCAAGTGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-33s21c1
Sequence:CCGGGAGAATCTTCTGGCGGCAGATCTCGAGATCTGCCGCCAGAAGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080438
A3GALT2 MISSION shRNA shRNA Plasmid DNA
alpha 1,3-galactosyltransferase 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-84s21c1
Sequence:CCGGTCTGTATGGCCTCCCTAAATTCTCGAGAATTTAGGGAGGCCATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-401s21c1
Sequence:CCGGGCGTGATGTACTACGTGTTCACTCGAGTGAACACGTAGTACATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-305s21c1
Sequence:CCGGCCATTGGGCTGACTATCTTTGCTCGAGCAAAGATAGTCAGCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-56s21c1
Sequence:CCGGTACTTACACTTGGCCTCTTAGCTCGAGCTAAGAGGCCAAGTGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-33s21c1
Sequence:CCGGGAGAATCTTCTGGCGGCAGATCTCGAGATCTGCCGCCAGAAGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080438
A3GALT2 MISSION shRNA Lentiviral Transduction Particles
alpha 1,3-galactosyltransferase 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-84s21c1
Sequence:CCGGTCTGTATGGCCTCCCTAAATTCTCGAGAATTTAGGGAGGCCATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-401s21c1
Sequence:CCGGGCGTGATGTACTACGTGTTCACTCGAGTGAACACGTAGTACATCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-305s21c1
Sequence:CCGGCCATTGGGCTGACTATCTTTGCTCGAGCAAAGATAGTCAGCCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-56s21c1
Sequence:CCGGTACTTACACTTGGCCTCTTAGCTCGAGCTAAGAGGCCAAGTGTAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080438.1-33s21c1
Sequence:CCGGGAGAATCTTCTGGCGGCAGATCTCGAGATCTGCCGCCAGAAGATTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks