EMAIL THIS PAGE TO A FRIEND

A4GALT

alpha 1,4-galactosyltransferase

49 Gene Product Result for
Synonyms: A14GALT A4GALT1 Gb3S P(k) P1 P1PK PK
UniProtKB ID: Q9NPC4, B2R7C4, Q9P1X5
Gene ID:
Human(53947) Summary: The protein encoded by this gene catalyzes the transfer of galactose to lactosylceramide to form globotriaosylceramide, which has been identified as the P(k) antigen of the P blood group system. The encoded protein, which is a type II membrane protein found in the Golgi, is also required for the synthesis of the bacterial verotoxins receptor. [provided by RefSeq, Jul 2008]
Mouse(239559) alpha 1,4-galactosyltransferase
Rat(63888) alpha 1,4-galactosyltransferase
naked mole-rat(101717743) alpha 1,4-galactosyltransferase
domestic guinea pig(100721247) alpha 1,4-galactosyltransferase
sheep(101106675) alpha 1,4-galactosyltransferase
chicken(418223) alpha 1,4-galactosyltransferase
cow(618369) alpha 1,4-galactosyltransferase
domestic cat(101085732) alpha 1,4-galactosyltransferase
dog(481222) alpha 1,4-galactosyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017436 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017436 Rosetta Predictions human pricing
NM_022240 Rosetta Predictions rat pricing
NM_001004150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224825 predicted 822
2 SASI_Hs01_00224826 predicted 1688
3 SASI_Hs01_00224827 predicted 959
4 SASI_Hs01_00224828 predicted 1191
5 SASI_Hs01_00224829 predicted 934
6 SASI_Hs01_00224830 predicted 839
7 SASI_Hs01_00224831 predicted 1519
8 SASI_Hs01_00224832 predicted 1012
9 SASI_Hs01_00224833 predicted 803
10 SASI_Hs01_00224834 predicted 1427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089698 predicted 475
2 SASI_Rn01_00089700 predicted 313
3 SASI_Rn01_00089701 predicted 1292
4 SASI_Rn01_00089703 predicted 1124
5 SASI_Rn01_00089704 predicted 322
6 SASI_Rn01_00089705 predicted 603
7 SASI_Rn01_00089706 predicted 1309
8 SASI_Rn01_00089707 predicted 1017
9 SASI_Rn02_00263014 predicted 697
10 SASI_Rn02_00263015 predicted 1160
11 SASI_Rn01_00089699 predicted 282
12 SASI_Rn01_00089702 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286465 predicted 1222
2 SASI_Mm02_00286466 predicted 913
3 SASI_Mm02_00286467 predicted 365
4 SASI_Mm02_00286468 predicted 1361
5 SASI_Mm02_00286469 predicted 760
6 SASI_Mm02_00286470 predicted 428
7 SASI_Mm02_00286471 predicted 774
8 SASI_Mm02_00286472 predicted 1282
9 SASI_Mm02_00286473 predicted 1141
10 SASI_Mm02_00286474 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004150
A4GALT MISSION shRNA Bacterial Glycerol Stock
alpha 1,4-galactosyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004150.1-1214s1c1
Sequence:CCGGCCCAGCTACATGCCCGCTATTCTCGAGAATAGCGGGCATGTAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004150.1-1139s1c1
Sequence:CCGGCCACCTATGCTGTTCATGTGTCTCGAGACACATGAACAGCATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004150.1-362s1c1
Sequence:CCGGCCAAGGACCAAAGAGAGTATACTCGAGTATACTCTCTTTGGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004150.1-436s1c1
Sequence:CCGGCCAGGCAACATCTTCTTCCTACTCGAGTAGGAAGAAGATGTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004150.1-1287s1c1
Sequence:CCGGGCAGTCATATCATATCAACATCTCGAGATGTTGATATGATATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004150
A4GALT MISSION shRNA shRNA Plasmid DNA
alpha 1,4-galactosyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004150.1-1214s1c1
Sequence:CCGGCCCAGCTACATGCCCGCTATTCTCGAGAATAGCGGGCATGTAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004150.1-1139s1c1
Sequence:CCGGCCACCTATGCTGTTCATGTGTCTCGAGACACATGAACAGCATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004150.1-362s1c1
Sequence:CCGGCCAAGGACCAAAGAGAGTATACTCGAGTATACTCTCTTTGGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004150.1-436s1c1
Sequence:CCGGCCAGGCAACATCTTCTTCCTACTCGAGTAGGAAGAAGATGTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004150.1-1287s1c1
Sequence:CCGGGCAGTCATATCATATCAACATCTCGAGATGTTGATATGATATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004150
A4GALT MISSION shRNA Lentiviral Transduction Particles
alpha 1,4-galactosyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004150.1-1214s1c1
Sequence:CCGGCCCAGCTACATGCCCGCTATTCTCGAGAATAGCGGGCATGTAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004150.1-1139s1c1
Sequence:CCGGCCACCTATGCTGTTCATGTGTCTCGAGACACATGAACAGCATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004150.1-362s1c1
Sequence:CCGGCCAAGGACCAAAGAGAGTATACTCGAGTATACTCTCTTTGGTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004150.1-436s1c1
Sequence:CCGGCCAGGCAACATCTTCTTCCTACTCGAGTAGGAAGAAGATGTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004150.1-1287s1c1
Sequence:CCGGGCAGTCATATCATATCAACATCTCGAGATGTTGATATGATATGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017436
A4GALT MISSION shRNA Bacterial Glycerol Stock
alpha 1,4-galactosyltransferase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-796s1c1
Sequence:CCGGCACGGACTTCATTGTTCTCAACTCGAGTTGAGAACAATGAAGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-991s1c1
Sequence:CCGGCTTCAAGAAGTGGTGTTCCATCTCGAGATGGAACACCACTTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-757s1c1
Sequence:CCGGGATCGCACTCATGTGGAAGTTCTCGAGAACTTCCACATGAGTGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-289s1c1
Sequence:CCGGGTTCATCATCGGCTTCAAGTTCTCGAGAACTTGAAGCCGATGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-1088s1c1
Sequence:CCGGCAGGACTGGAAGAAGTACTTTCTCGAGAAAGTACTTCTTCCAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017436.4-1716s21c1
Sequence:CCGGAGGAGGCTGTTGGTAGGAAAGCTCGAGCTTTCCTACCAACAGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017436.4-587s21c1
Sequence:CCGGACGTGCTGGTCCTGATGAAAGCTCGAGCTTTCATCAGGACCAGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017436.4-402s21c1
Sequence:CCGGGGAGAAAGGGCAGCTCTATAACTCGAGTTATAGAGCTGCCCTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017436
A4GALT MISSION shRNA shRNA Plasmid DNA
alpha 1,4-galactosyltransferase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-796s1c1
Sequence:CCGGCACGGACTTCATTGTTCTCAACTCGAGTTGAGAACAATGAAGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-991s1c1
Sequence:CCGGCTTCAAGAAGTGGTGTTCCATCTCGAGATGGAACACCACTTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-757s1c1
Sequence:CCGGGATCGCACTCATGTGGAAGTTCTCGAGAACTTCCACATGAGTGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-289s1c1
Sequence:CCGGGTTCATCATCGGCTTCAAGTTCTCGAGAACTTGAAGCCGATGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-1088s1c1
Sequence:CCGGCAGGACTGGAAGAAGTACTTTCTCGAGAAAGTACTTCTTCCAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017436.4-1716s21c1
Sequence:CCGGAGGAGGCTGTTGGTAGGAAAGCTCGAGCTTTCCTACCAACAGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017436.4-587s21c1
Sequence:CCGGACGTGCTGGTCCTGATGAAAGCTCGAGCTTTCATCAGGACCAGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017436.4-402s21c1
Sequence:CCGGGGAGAAAGGGCAGCTCTATAACTCGAGTTATAGAGCTGCCCTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017436
A4GALT MISSION shRNA Lentiviral Transduction Particles
alpha 1,4-galactosyltransferase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-796s1c1
Sequence:CCGGCACGGACTTCATTGTTCTCAACTCGAGTTGAGAACAATGAAGTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-991s1c1
Sequence:CCGGCTTCAAGAAGTGGTGTTCCATCTCGAGATGGAACACCACTTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-757s1c1
Sequence:CCGGGATCGCACTCATGTGGAAGTTCTCGAGAACTTCCACATGAGTGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-289s1c1
Sequence:CCGGGTTCATCATCGGCTTCAAGTTCTCGAGAACTTGAAGCCGATGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017436.3-1088s1c1
Sequence:CCGGCAGGACTGGAAGAAGTACTTTCTCGAGAAAGTACTTCTTCCAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436882    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017436.4-1716s21c1
Sequence:CCGGAGGAGGCTGTTGGTAGGAAAGCTCGAGCTTTCCTACCAACAGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017436.4-587s21c1
Sequence:CCGGACGTGCTGGTCCTGATGAAAGCTCGAGCTTTCATCAGGACCAGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017436.4-402s21c1
Sequence:CCGGGGAGAAAGGGCAGCTCTATAACTCGAGTTATAGAGCTGCCCTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks