EMAIL THIS PAGE TO A FRIEND

A4GNT

alpha-1,4-N-acetylglucosaminyltransferase

60 Gene Product Result for
Synonyms: alpha4GnT
UniProtKB ID: Q9UNA3, Q0VDK1, Q0VDK2
Gene ID:
Human(51146) Summary: This gene encodes a protein from the glycosyltransferase 32 family. The enzyme catalyzes the transfer of N-acetylglucosamine (GlcNAc) to core 2 branched O-glycans. It forms a unique glycan, GlcNAcalpha1-->4Galbeta-->R and is largely associated with the Golgi apparatus membrane. [provided by RefSeq, Jul 2008]
Mouse(333424) alpha-1,4-N-acetylglucosaminyltransferase
Rat(685758) alpha-1,4-N-acetylglucosaminyltransferase
chicken(429136) alpha-1,4-N-acetylglucosaminyltransferase
cow(540795) alpha-1,4-N-acetylglucosaminyltransferase
domestic cat(101093541) alpha-1,4-N-acetylglucosaminyltransferase
dog(485683) alpha-1,4-N-acetylglucosaminyltransferase
sheep(101111851) alpha-1,4-N-acetylglucosaminyltransferase
domestic guinea pig(100726046) alpha-1,4-N-acetylglucosaminyltransferase
naked mole-rat(101723146) alpha-1,4-N-acetylglucosaminyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016161 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001077424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001077424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001077424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU156891 MISSION® esiRNA esiRNA targeting mouse A4gnt mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016161 Rosetta Predictions human pricing
XM_001065156 Rosetta Predictions rat pricing
NM_001077424 Rosetta Predictions mouse pricing
XM_286168 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348964 predicted 1053
2 SASI_Hs02_00348965 predicted 1146
3 SASI_Hs01_00175301 predicted 870
4 SASI_Hs02_00348966 predicted 883
5 SASI_Hs01_00175302 predicted 633
6 SASI_Hs02_00348967 predicted 1154
7 SASI_Hs01_00175305 predicted 1012
8 SASI_Hs02_00348968 predicted 680
9 SASI_Hs02_00348969 predicted 897
10 SASI_Hs02_00348970 predicted 429
11 SASI_Hs01_00175296 predicted 700
12 SASI_Hs01_00175297 predicted 326
13 SASI_Hs01_00175298 predicted 397
14 SASI_Hs01_00175299 predicted 846
15 SASI_Hs01_00175300 predicted 999
16 SASI_Hs01_00175303 predicted 419
17 SASI_Hs01_00175304 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313092 predicted 339
2 SASI_Rn02_00313093 predicted 1318
3 SASI_Rn02_00313094 predicted 1152
4 SASI_Rn02_00313095 predicted 872
5 SASI_Rn02_00313096 predicted 891
6 SASI_Rn02_00313097 predicted 1068
7 SASI_Rn02_00313098 predicted 1028
8 SASI_Rn02_00313099 predicted 1089
9 SASI_Rn02_00313100 predicted 1006
10 SASI_Rn02_00313101 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292662 predicted 428
2 SASI_Mm02_00292663 predicted 345
3 SASI_Mm02_00292664 predicted 211
4 SASI_Mm02_00292665 predicted 343
5 SASI_Mm02_00292666 predicted 552
6 SASI_Mm02_00292667 predicted 759
7 SASI_Mm02_00292668 predicted 208
8 SASI_Mm02_00292669 predicted 381
9 SASI_Mm02_00292670 predicted 800
10 SASI_Mm02_00292671 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_286168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239078 predicted 1040
2 SASI_Mm01_00239079 predicted 1349
3 SASI_Mm01_00239080 predicted 673
4 SASI_Mm01_00239081 predicted 1359
5 SASI_Mm01_00239082 predicted 1136
6 SASI_Mm01_00239083 predicted 867
7 SASI_Mm01_00239084 predicted 1012
8 SASI_Mm01_00239085 predicted 1473
9 SASI_Mm01_00239086 predicted 1325
10 SASI_Mm01_00239087 predicted 1357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016161
A4GNT MISSION shRNA Bacterial Glycerol Stock
alpha-1,4-N-acetylglucosaminyltransferase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016161.2-1515s21c1
Sequence:CCGGTTCCTGCAAGTACCGTATAACCTCGAGGTTATACGGTACTTGCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016161.2-1157s21c1
Sequence:CCGGACTTACAGGGACCTGATTAAACTCGAGTTTAATCAGGTCCCTGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016161.2-1405s21c1
Sequence:CCGGCATACACCCATGGTCCATTTGCTCGAGCAAATGGACCATGGGTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-1038s1c1
Sequence:CCGGCCTGCATTTGTGGAACCACATCTCGAGATGTGGTTCCACAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-742s1c1
Sequence:CCGGCGGTACTCTAGTAATGGAATACTCGAGTATTCCATTACTAGAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-430s1c1
Sequence:CCGGGTGTTCTTTATGAAGGGTCTTCTCGAGAAGACCCTTCATAAAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-988s1c1
Sequence:CCGGCGCTACTATGAAGTGTGGGATCTCGAGATCCCACACTTCATAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-817s1c1
Sequence:CCGGGAACACTATAATTCAGCCATTCTCGAGAATGGCTGAATTATAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016161
A4GNT MISSION shRNA shRNA Plasmid DNA
alpha-1,4-N-acetylglucosaminyltransferase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016161.2-1515s21c1
Sequence:CCGGTTCCTGCAAGTACCGTATAACCTCGAGGTTATACGGTACTTGCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016161.2-1157s21c1
Sequence:CCGGACTTACAGGGACCTGATTAAACTCGAGTTTAATCAGGTCCCTGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016161.2-1405s21c1
Sequence:CCGGCATACACCCATGGTCCATTTGCTCGAGCAAATGGACCATGGGTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-1038s1c1
Sequence:CCGGCCTGCATTTGTGGAACCACATCTCGAGATGTGGTTCCACAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-742s1c1
Sequence:CCGGCGGTACTCTAGTAATGGAATACTCGAGTATTCCATTACTAGAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-430s1c1
Sequence:CCGGGTGTTCTTTATGAAGGGTCTTCTCGAGAAGACCCTTCATAAAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-988s1c1
Sequence:CCGGCGCTACTATGAAGTGTGGGATCTCGAGATCCCACACTTCATAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-817s1c1
Sequence:CCGGGAACACTATAATTCAGCCATTCTCGAGAATGGCTGAATTATAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016161
A4GNT MISSION shRNA Lentiviral Transduction Particles
alpha-1,4-N-acetylglucosaminyltransferase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016161.2-1515s21c1
Sequence:CCGGTTCCTGCAAGTACCGTATAACCTCGAGGTTATACGGTACTTGCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016161.2-1157s21c1
Sequence:CCGGACTTACAGGGACCTGATTAAACTCGAGTTTAATCAGGTCCCTGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016161.2-1405s21c1
Sequence:CCGGCATACACCCATGGTCCATTTGCTCGAGCAAATGGACCATGGGTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-1038s1c1
Sequence:CCGGCCTGCATTTGTGGAACCACATCTCGAGATGTGGTTCCACAAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-742s1c1
Sequence:CCGGCGGTACTCTAGTAATGGAATACTCGAGTATTCCATTACTAGAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-430s1c1
Sequence:CCGGGTGTTCTTTATGAAGGGTCTTCTCGAGAAGACCCTTCATAAAGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-988s1c1
Sequence:CCGGCGCTACTATGAAGTGTGGGATCTCGAGATCCCACACTTCATAGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016161.1-817s1c1
Sequence:CCGGGAACACTATAATTCAGCCATTCTCGAGAATGGCTGAATTATAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077424
A4GNT MISSION shRNA Bacterial Glycerol Stock
alpha-1,4-N-acetylglucosaminyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-349s21c1
Sequence:CCGGTCCGTACAGCTGACTTCAAATCTCGAGATTTGAAGTCAGCTGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-217s21c1
Sequence:CCGGGGACGAAGCATCATGTTTATACTCGAGTATAAACATGATGCTTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-388s21c1
Sequence:CCGGTCCCTCCTCTCGGCCATTAATCTCGAGATTAATGGCCGAGAGGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-768s21c1
Sequence:CCGGACGGGTGTGGTGTCGTCTTAACTCGAGTTAAGACGACACCACACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-808s21c1
Sequence:CCGGGACCTGAAGTGTTTGAATATTCTCGAGAATATTCAAACACTTCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077424
A4GNT MISSION shRNA shRNA Plasmid DNA
alpha-1,4-N-acetylglucosaminyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-349s21c1
Sequence:CCGGTCCGTACAGCTGACTTCAAATCTCGAGATTTGAAGTCAGCTGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-217s21c1
Sequence:CCGGGGACGAAGCATCATGTTTATACTCGAGTATAAACATGATGCTTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-388s21c1
Sequence:CCGGTCCCTCCTCTCGGCCATTAATCTCGAGATTAATGGCCGAGAGGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-768s21c1
Sequence:CCGGACGGGTGTGGTGTCGTCTTAACTCGAGTTAAGACGACACCACACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-808s21c1
Sequence:CCGGGACCTGAAGTGTTTGAATATTCTCGAGAATATTCAAACACTTCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077424
A4GNT MISSION shRNA Lentiviral Transduction Particles
alpha-1,4-N-acetylglucosaminyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-349s21c1
Sequence:CCGGTCCGTACAGCTGACTTCAAATCTCGAGATTTGAAGTCAGCTGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-217s21c1
Sequence:CCGGGGACGAAGCATCATGTTTATACTCGAGTATAAACATGATGCTTCGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-388s21c1
Sequence:CCGGTCCCTCCTCTCGGCCATTAATCTCGAGATTAATGGCCGAGAGGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-768s21c1
Sequence:CCGGACGGGTGTGGTGTCGTCTTAACTCGAGTTAAGACGACACCACACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077424.1-808s21c1
Sequence:CCGGGACCTGAAGTGTTTGAATATTCTCGAGAATATTCAAACACTTCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks