EMAIL THIS PAGE TO A FRIEND

AAAS

achalasia, adrenocortical insufficiency, alacrimia

51 Gene Product Result for
Synonyms: AAA AAASb ADRACALA ADRACALIN ALADIN
UniProtKB ID: Q9NRG9, Q5JB47, Q9NWI6, Q9UG19
Gene ID:
Human(8086) Summary: The protein encoded by this gene is a member of the WD-repeat family of regulatory proteins and may be involved in normal development of the peripheral and central nervous system. The encoded protein is part of the nuclear pore complex and is anchored there by NDC1. Defects in this gene are a cause of achalasia-addisonianism-alacrima syndrome (AAAS), also called triple-A syndrome or Allgrove syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(223921) achalasia, adrenocortical insufficiency, alacrimia
Rat(300259) achalasia, adrenocortical insufficiency, alacrimia
Zebrafish(378454) achalasia, adrenocortical insufficiency, alacrimia
cow(506561) achalasia, adrenocortical insufficiency, alacrimia
Horse(100063811) achalasia, adrenocortical insufficiency, alacrimia
domestic cat(101085052) achalasia, adrenocortical insufficiency, alacrimia
dog(607867) achalasia, adrenocortical insufficiency, alacrimia
chicken(100859661) achalasia, adrenocortical insufficiency, alacrimia
naked mole-rat(101726045) achalasia, adrenocortical insufficiency, alacrimia
domestic guinea pig(100727054) achalasia, adrenocortical insufficiency, alacrimia
sheep(101104648) achalasia, adrenocortical insufficiency, alacrimia
Domestic Rabbit(100356621) achalasia, adrenocortical insufficiency, alacrimia
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015665 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015665 Rosetta Predictions human pricing
NM_001106795 Rosetta Predictions rat pricing
NM_153416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079270 predicted 1428
2 SASI_Hs01_00079271 predicted 1278
3 SASI_Hs02_00348287 predicted 203
4 SASI_Hs01_00079273 predicted 291
5 SASI_Hs01_00079274 predicted 1138
6 SASI_Hs01_00079275 predicted 955
7 SASI_Hs01_00079278 predicted 590
8 SASI_Hs01_00079279 predicted 1591
9 SASI_Hs02_00348288 predicted 1238
10 SASI_Hs02_00348289 predicted 569
11 SASI_Hs01_00079272 predicted 433
12 SASI_Hs01_00079276 predicted 530
13 SASI_Hs01_00079277 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222478 predicted 511
2 SASI_Rn02_00222479 predicted 1333
3 SASI_Rn02_00222480 predicted 1026
4 SASI_Rn02_00222481 predicted 1254
5 SASI_Rn02_00222482 predicted 1279
6 SASI_Rn02_00222483 predicted 1313
7 SASI_Rn02_00222484 predicted 354
8 SASI_Rn02_00222485 predicted 1668
9 SASI_Rn02_00222486 predicted 671
10 SASI_Rn02_00222487 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036902 predicted 881
2 SASI_Mm01_00036903 predicted 1179
3 SASI_Mm02_00343205 predicted 1447
4 SASI_Mm01_00036904 predicted 989
5 SASI_Mm01_00036905 predicted 365
6 SASI_Mm01_00036906 predicted 1519
7 SASI_Mm01_00036907 predicted 1493
8 SASI_Mm01_00036908 predicted 1129
9 SASI_Mm02_00343206 predicted 208
10 SASI_Mm01_00036909 predicted 507
11 SASI_Mm01_00036901 predicted 1533
12 SASI_Mm01_00036910 predicted 900
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015665
VALIDATED
AAAS MISSION shRNA Bacterial Glycerol Stock
achalasia, adrenocortical insufficiency, alacrimia
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015665.5-1301s21c1
Sequence:CCGGGATCTGTCTGAGACAACAATACTCGAGTATTGTTGTCTCAGACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015665.5-1126s21c1
Sequence:CCGGTGAGAGGTGGCCTACTCTATCCTCGAGGATAGAGTAGGCCACCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015665.5-1388s21c1
Sequence:CCGGGAACGTCTGGCTGTGCTTATGCTCGAGCATAAGCACAGCCAGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015665.5-291s21c1
Sequence:CCGGTCAATCTTCCTGTCCTACAACCTCGAGGTTGTAGGACAGGAAGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015665.3-363s1c1
Sequence:CCGGTGCATCAACATTTGGCGTGATCTCGAGATCACGCCAAATGTTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015665.3-533s1c1
Sequence:CCGGCGAAGATCTGATCGCTGAATTCTCGAGAATTCAGCGATCAGATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015665.3-1380s1c1
Sequence:CCGGCCAAGGGTACAGGATGGTAAACTCGAGTTTACCATCCTGTACCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015665.3-532s1c1
Sequence:CCGGGCGAAGATCTGATCGCTGAATCTCGAGATTCAGCGATCAGATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015665
VALIDATED
AAAS MISSION shRNA shRNA Plasmid DNA
achalasia, adrenocortical insufficiency, alacrimia
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015665.5-1301s21c1
Sequence:CCGGGATCTGTCTGAGACAACAATACTCGAGTATTGTTGTCTCAGACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015665.5-1126s21c1
Sequence:CCGGTGAGAGGTGGCCTACTCTATCCTCGAGGATAGAGTAGGCCACCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015665.5-1388s21c1
Sequence:CCGGGAACGTCTGGCTGTGCTTATGCTCGAGCATAAGCACAGCCAGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015665.5-291s21c1
Sequence:CCGGTCAATCTTCCTGTCCTACAACCTCGAGGTTGTAGGACAGGAAGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015665.3-363s1c1
Sequence:CCGGTGCATCAACATTTGGCGTGATCTCGAGATCACGCCAAATGTTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015665.3-533s1c1
Sequence:CCGGCGAAGATCTGATCGCTGAATTCTCGAGAATTCAGCGATCAGATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015665.3-1380s1c1
Sequence:CCGGCCAAGGGTACAGGATGGTAAACTCGAGTTTACCATCCTGTACCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015665.3-532s1c1
Sequence:CCGGGCGAAGATCTGATCGCTGAATCTCGAGATTCAGCGATCAGATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015665
VALIDATED
AAAS MISSION shRNA Lentiviral Transduction Particles
achalasia, adrenocortical insufficiency, alacrimia
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015665.5-1301s21c1
Sequence:CCGGGATCTGTCTGAGACAACAATACTCGAGTATTGTTGTCTCAGACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015665.5-1126s21c1
Sequence:CCGGTGAGAGGTGGCCTACTCTATCCTCGAGGATAGAGTAGGCCACCTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015665.5-1388s21c1
Sequence:CCGGGAACGTCTGGCTGTGCTTATGCTCGAGCATAAGCACAGCCAGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015665.5-291s21c1
Sequence:CCGGTCAATCTTCCTGTCCTACAACCTCGAGGTTGTAGGACAGGAAGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015665.3-363s1c1
Sequence:CCGGTGCATCAACATTTGGCGTGATCTCGAGATCACGCCAAATGTTGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015665.3-533s1c1
Sequence:CCGGCGAAGATCTGATCGCTGAATTCTCGAGAATTCAGCGATCAGATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015665.3-1380s1c1
Sequence:CCGGCCAAGGGTACAGGATGGTAAACTCGAGTTTACCATCCTGTACCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015665.3-532s1c1
Sequence:CCGGGCGAAGATCTGATCGCTGAATCTCGAGATTCAGCGATCAGATCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153416
VALIDATED
AAAS MISSION shRNA Bacterial Glycerol Stock
achalasia, adrenocortical insufficiency, alacrimia
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153416.1-512s1c1
Sequence:CCGGGAATTTGCCCAAGTAACTAACCTCGAGGTTAGTTACTTGGGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153416.1-512s21c1
Sequence:CCGGGAATTTGCCCAAGTAACTAACCTCGAGGTTAGTTACTTGGGCAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153416.1-1409s21c1
Sequence:CCGGCTGCTTCCCTGTGGTATTATTCTCGAGAATAATACCACAGGGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153416.1-1551s21c1
Sequence:CCGGATGCTCAGTTTCCACGCTTTACTCGAGTAAAGCGTGGAAACTGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153416.1-1002s21c1
Sequence:CCGGCTACTCCTTCTGCCATCTTTACTCGAGTAAAGATGGCAGAAGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153416.1-602s21c1
Sequence:CCGGGACGACTCCATCCGTGTTTATCTCGAGATAAACACGGATGGAGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153416.1-274s1c1
Sequence:CCGGCCATGGTACAAGAACTGCCTTCTCGAGAAGGCAGTTCTTGTACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153416.1-1535s1c1
Sequence:CCGGCCTCTGTACTTTGTCAATGCTCTCGAGAGCATTGACAAAGTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153416.1-726s1c1
Sequence:CCGGGCCAGAGCTGTATTCTCATCTCTCGAGAGATGAGAATACAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153416
VALIDATED
AAAS MISSION shRNA shRNA Plasmid DNA
achalasia, adrenocortical insufficiency, alacrimia
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153416.1-512s1c1
Sequence:CCGGGAATTTGCCCAAGTAACTAACCTCGAGGTTAGTTACTTGGGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153416.1-512s21c1
Sequence:CCGGGAATTTGCCCAAGTAACTAACCTCGAGGTTAGTTACTTGGGCAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153416.1-1409s21c1
Sequence:CCGGCTGCTTCCCTGTGGTATTATTCTCGAGAATAATACCACAGGGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153416.1-1551s21c1
Sequence:CCGGATGCTCAGTTTCCACGCTTTACTCGAGTAAAGCGTGGAAACTGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153416.1-1002s21c1
Sequence:CCGGCTACTCCTTCTGCCATCTTTACTCGAGTAAAGATGGCAGAAGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153416.1-602s21c1
Sequence:CCGGGACGACTCCATCCGTGTTTATCTCGAGATAAACACGGATGGAGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153416.1-274s1c1
Sequence:CCGGCCATGGTACAAGAACTGCCTTCTCGAGAAGGCAGTTCTTGTACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153416.1-1535s1c1
Sequence:CCGGCCTCTGTACTTTGTCAATGCTCTCGAGAGCATTGACAAAGTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153416.1-726s1c1
Sequence:CCGGGCCAGAGCTGTATTCTCATCTCTCGAGAGATGAGAATACAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153416
VALIDATED
AAAS MISSION shRNA Lentiviral Transduction Particles
achalasia, adrenocortical insufficiency, alacrimia
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153416.1-512s1c1
Sequence:CCGGGAATTTGCCCAAGTAACTAACCTCGAGGTTAGTTACTTGGGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153416.1-512s21c1
Sequence:CCGGGAATTTGCCCAAGTAACTAACCTCGAGGTTAGTTACTTGGGCAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153416.1-1409s21c1
Sequence:CCGGCTGCTTCCCTGTGGTATTATTCTCGAGAATAATACCACAGGGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153416.1-1551s21c1
Sequence:CCGGATGCTCAGTTTCCACGCTTTACTCGAGTAAAGCGTGGAAACTGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153416.1-1002s21c1
Sequence:CCGGCTACTCCTTCTGCCATCTTTACTCGAGTAAAGATGGCAGAAGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153416.1-602s21c1
Sequence:CCGGGACGACTCCATCCGTGTTTATCTCGAGATAAACACGGATGGAGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153416.1-274s1c1
Sequence:CCGGCCATGGTACAAGAACTGCCTTCTCGAGAAGGCAGTTCTTGTACCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153416.1-1535s1c1
Sequence:CCGGCCTCTGTACTTTGTCAATGCTCTCGAGAGCATTGACAAAGTACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184602    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153416.1-726s1c1
Sequence:CCGGGCCAGAGCTGTATTCTCATCTCTCGAGAGATGAGAATACAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks