EMAIL THIS PAGE TO A FRIEND

AACS

acetoacetyl-CoA synthetase

52 Gene Product Result for
Synonyms: ACSF1 SUR-5
Gene ID:
Mouse(78894) acetoacetyl-CoA synthetase
Rat(65984) acetoacetyl-CoA synthetase
Zebrafish(393984) acetoacetyl-CoA synthetase
domestic cat(101082951) acetoacetyl-CoA synthetase
cow(505842) acetoacetyl-CoA synthetase
dog(486240) acetoacetyl-CoA synthetase
chicken(416811) acetoacetyl-CoA synthetase
naked mole-rat(101700737) acetoacetyl-CoA synthetase
domestic guinea pig(100718257) acetoacetyl-CoA synthetase
sheep(101114977) acetoacetyl-CoA synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023928 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023928 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023928 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030210 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030210 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030210 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023928 Rosetta Predictions human pricing
NM_023104 Rosetta Predictions rat pricing
NM_030210 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023928 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239982 predicted 942
2 SASI_Hs01_00239983 predicted 2080
3 SASI_Hs01_00239984 predicted 541
4 SASI_Hs01_00239985 predicted 1435
5 SASI_Hs01_00239986 predicted 761
6 SASI_Hs01_00239987 predicted 1689
7 SASI_Hs01_00239988 predicted 1720
8 SASI_Hs01_00239990 predicted 570
9 SASI_Hs01_00239991 predicted 552
10 SASI_Hs02_00356390 predicted 1988
11 SASI_Hs01_00239989 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034851 predicted 409
2 SASI_Rn02_00263746 predicted 542
3 SASI_Rn01_00034852 predicted 1980
4 SASI_Rn01_00034853 predicted 1422
5 SASI_Rn01_00034854 predicted 669
6 SASI_Rn01_00034855 predicted 1367
7 SASI_Rn01_00034856 predicted 240
8 SASI_Rn01_00034858 predicted 443
9 SASI_Rn01_00034859 predicted 2029
10 SASI_Rn02_00263747 predicted 1986
11 SASI_Rn01_00034857 predicted 1989
12 SASI_Rn01_00034860 predicted 1358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030210 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030271 predicted 448
2 SASI_Mm01_00030272 predicted 2153
3 SASI_Mm02_00336639 predicted 1422
4 SASI_Mm02_00336640 predicted 689
5 SASI_Mm01_00030273 predicted 1616
6 SASI_Mm01_00030274 predicted 1074
7 SASI_Mm01_00030275 predicted 1296
8 SASI_Mm01_00030276 predicted 651
9 SASI_Mm01_00030277 predicted 403
10 SASI_Mm01_00030278 predicted 233
11 SASI_Mm01_00030279 predicted 1368
12 SASI_Mm01_00030280 predicted 712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023928
VALIDATED
AACS MISSION shRNA Bacterial Glycerol Stock
acetoacetyl-CoA synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023928.2-1381s1c1
Sequence:CCGGCGAGTATGTCTACAGGTGCATCTCGAGATGCACCTGTAGACATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023928.2-1621s1c1
Sequence:CCGGGAACGATGAGAACGGCAACAACTCGAGTTGTTGCCGTTCTCATCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023928.2-364s1c1
Sequence:CCGGTGTGGACACATCGAAAGGAATCTCGAGATTCCTTTCGATGTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023928.2-190s1c1
Sequence:CCGGCAGTAAGAAGAACACGCAGATCTCGAGATCTGCGTGTTCTTCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023928.2-749s1c1
Sequence:CCGGGCTGTTGTCTATAATGGCAAACTCGAGTTTGCCATTATAGACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023928.3-665s21c1
Sequence:CCGGAGATCGGGTTGTTGGTTATTTCTCGAGAAATAACCAACAACCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023928.3-1721s21c1
Sequence:CCGGCAAGTACAGGAAGGCGTATTTCTCGAGAAATACGCCTTCCTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023928.3-1864s21c1
Sequence:CCGGGCTCGGAAATCTATAACATTGCTCGAGCAATGTTATAGATTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023928.3-2591s21c1
Sequence:CCGGTTGCTCTGTGAAGGTGCAAATCTCGAGATTTGCACCTTCACAGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023928.3-360s21c1
Sequence:CCGGCATTGGTCCGTTGAGTCATATCTCGAGATATGACTCAACGGACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023928
VALIDATED
AACS MISSION shRNA shRNA Plasmid DNA
acetoacetyl-CoA synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023928.2-1381s1c1
Sequence:CCGGCGAGTATGTCTACAGGTGCATCTCGAGATGCACCTGTAGACATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023928.2-1621s1c1
Sequence:CCGGGAACGATGAGAACGGCAACAACTCGAGTTGTTGCCGTTCTCATCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023928.2-364s1c1
Sequence:CCGGTGTGGACACATCGAAAGGAATCTCGAGATTCCTTTCGATGTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023928.2-190s1c1
Sequence:CCGGCAGTAAGAAGAACACGCAGATCTCGAGATCTGCGTGTTCTTCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023928.2-749s1c1
Sequence:CCGGGCTGTTGTCTATAATGGCAAACTCGAGTTTGCCATTATAGACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023928.3-665s21c1
Sequence:CCGGAGATCGGGTTGTTGGTTATTTCTCGAGAAATAACCAACAACCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023928.3-1721s21c1
Sequence:CCGGCAAGTACAGGAAGGCGTATTTCTCGAGAAATACGCCTTCCTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023928.3-1864s21c1
Sequence:CCGGGCTCGGAAATCTATAACATTGCTCGAGCAATGTTATAGATTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023928.3-2591s21c1
Sequence:CCGGTTGCTCTGTGAAGGTGCAAATCTCGAGATTTGCACCTTCACAGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023928.3-360s21c1
Sequence:CCGGCATTGGTCCGTTGAGTCATATCTCGAGATATGACTCAACGGACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023928
VALIDATED
AACS MISSION shRNA Lentiviral Transduction Particles
acetoacetyl-CoA synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023928.2-1381s1c1
Sequence:CCGGCGAGTATGTCTACAGGTGCATCTCGAGATGCACCTGTAGACATACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023928.2-1621s1c1
Sequence:CCGGGAACGATGAGAACGGCAACAACTCGAGTTGTTGCCGTTCTCATCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023928.2-364s1c1
Sequence:CCGGTGTGGACACATCGAAAGGAATCTCGAGATTCCTTTCGATGTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023928.2-190s1c1
Sequence:CCGGCAGTAAGAAGAACACGCAGATCTCGAGATCTGCGTGTTCTTCTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023928.2-749s1c1
Sequence:CCGGGCTGTTGTCTATAATGGCAAACTCGAGTTTGCCATTATAGACAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023928.3-665s21c1
Sequence:CCGGAGATCGGGTTGTTGGTTATTTCTCGAGAAATAACCAACAACCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023928.3-1721s21c1
Sequence:CCGGCAAGTACAGGAAGGCGTATTTCTCGAGAAATACGCCTTCCTGTACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023928.3-1864s21c1
Sequence:CCGGGCTCGGAAATCTATAACATTGCTCGAGCAATGTTATAGATTTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323253    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023928.3-2591s21c1
Sequence:CCGGTTGCTCTGTGAAGGTGCAAATCTCGAGATTTGCACCTTCACAGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023928.3-360s21c1
Sequence:CCGGCATTGGTCCGTTGAGTCATATCTCGAGATATGACTCAACGGACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030210
VALIDATED
AACS MISSION shRNA Bacterial Glycerol Stock
acetoacetyl-CoA synthetase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030210.1-2439s1c1
Sequence:CCGGCGCTGTTGTATCTCGCTCTATCTCGAGATAGAGCGAGATACAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030210.1-834s1c1
Sequence:CCGGCCCAAGGGAGAAGATTGACATCTCGAGATGTCAATCTTCTCCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030210.1-1150s1c1
Sequence:CCGGGCATCCTTGGTCCTGTATGATCTCGAGATCATACAGGACCAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030210.1-951s1c1
Sequence:CCGGCCACCCTCTGTTCATCATGTTCTCGAGAACATGATGAACAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030210.1-234s1c1
Sequence:CCGGGCTTGGGAATTACAATGACTTCTCGAGAAGTCATTGTAATTCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030210.1-261s21c1
Sequence:CCGGCTGGTCTGTCCGGTCGTATATCTCGAGATATACGACCGGACAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030210.1-834s21c1
Sequence:CCGGCCCAAGGGAGAAGATTGACATCTCGAGATGTCAATCTTCTCCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030210.1-2439s21c1
Sequence:CCGGCGCTGTTGTATCTCGCTCTATCTCGAGATAGAGCGAGATACAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030210.1-951s21c1
Sequence:CCGGCCACCCTCTGTTCATCATGTTCTCGAGAACATGATGAACAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030210.1-435s21c1
Sequence:CCGGGAACGACAGAGTCGCCCTTTACTCGAGTAAAGGGCGACTCTGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030210
VALIDATED
AACS MISSION shRNA shRNA Plasmid DNA
acetoacetyl-CoA synthetase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030210.1-2439s1c1
Sequence:CCGGCGCTGTTGTATCTCGCTCTATCTCGAGATAGAGCGAGATACAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030210.1-834s1c1
Sequence:CCGGCCCAAGGGAGAAGATTGACATCTCGAGATGTCAATCTTCTCCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030210.1-1150s1c1
Sequence:CCGGGCATCCTTGGTCCTGTATGATCTCGAGATCATACAGGACCAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030210.1-951s1c1
Sequence:CCGGCCACCCTCTGTTCATCATGTTCTCGAGAACATGATGAACAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030210.1-234s1c1
Sequence:CCGGGCTTGGGAATTACAATGACTTCTCGAGAAGTCATTGTAATTCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030210.1-261s21c1
Sequence:CCGGCTGGTCTGTCCGGTCGTATATCTCGAGATATACGACCGGACAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030210.1-834s21c1
Sequence:CCGGCCCAAGGGAGAAGATTGACATCTCGAGATGTCAATCTTCTCCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030210.1-2439s21c1
Sequence:CCGGCGCTGTTGTATCTCGCTCTATCTCGAGATAGAGCGAGATACAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030210.1-951s21c1
Sequence:CCGGCCACCCTCTGTTCATCATGTTCTCGAGAACATGATGAACAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030210.1-435s21c1
Sequence:CCGGGAACGACAGAGTCGCCCTTTACTCGAGTAAAGGGCGACTCTGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030210
VALIDATED
AACS MISSION shRNA Lentiviral Transduction Particles
acetoacetyl-CoA synthetase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076288    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030210.1-2439s1c1
Sequence:CCGGCGCTGTTGTATCTCGCTCTATCTCGAGATAGAGCGAGATACAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030210.1-834s1c1
Sequence:CCGGCCCAAGGGAGAAGATTGACATCTCGAGATGTCAATCTTCTCCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030210.1-1150s1c1
Sequence:CCGGGCATCCTTGGTCCTGTATGATCTCGAGATCATACAGGACCAAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030210.1-951s1c1
Sequence:CCGGCCACCCTCTGTTCATCATGTTCTCGAGAACATGATGAACAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030210.1-234s1c1
Sequence:CCGGGCTTGGGAATTACAATGACTTCTCGAGAAGTCATTGTAATTCCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030210.1-261s21c1
Sequence:CCGGCTGGTCTGTCCGGTCGTATATCTCGAGATATACGACCGGACAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030210.1-834s21c1
Sequence:CCGGCCCAAGGGAGAAGATTGACATCTCGAGATGTCAATCTTCTCCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030210.1-2439s21c1
Sequence:CCGGCGCTGTTGTATCTCGCTCTATCTCGAGATAGAGCGAGATACAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_030210.1-951s21c1
Sequence:CCGGCCACCCTCTGTTCATCATGTTCTCGAGAACATGATGAACAGAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030210.1-435s21c1
Sequence:CCGGGAACGACAGAGTCGCCCTTTACTCGAGTAAAGGGCGACTCTGTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks