EMAIL THIS PAGE TO A FRIEND

AADAC

arylacetamide deacetylase

47 Gene Product Result for
Synonyms: CES5A1 DAC
UniProtKB ID: P22760, A8K3L3, D3DNJ6, Q8N1A9
Gene ID:
Human(13) Summary: Microsomal arylacetamide deacetylase competes against the activity of cytosolic arylamine N-acetyltransferase, which catalyzes one of the initial biotransformation pathways for arylamine and heterocyclic amine carcinogens [provided by RefSeq, Jul 2008]
Mouse(67758) arylacetamide deacetylase (esterase)
Rat(57300) arylacetamide deacetylase
dog(477115) arylacetamide deacetylase
Horse(100056411) arylacetamide deacetylase
cow(519557) arylacetamide deacetylase (esterase)
domestic cat(101096344) arylacetamide deacetylase
domestic guinea pig(100723674) arylacetamide deacetylase
naked mole-rat(101706394) arylacetamide deacetylase
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001086 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001086 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001086 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023383 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023383 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023383 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027081 MISSION® esiRNA esiRNA human AADAC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001086 Rosetta Predictions human pricing
NM_020538 Rosetta Predictions rat pricing
NM_023383 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212161 predicted 507
2 SASI_Hs01_00212162 predicted 346
3 SASI_Hs01_00212163 predicted 852
4 SASI_Hs01_00212164 predicted 678
5 SASI_Hs01_00212165 predicted 716
6 SASI_Hs01_00212166 predicted 532
7 SASI_Hs01_00212167 predicted 630
8 SASI_Hs01_00212168 predicted 643
9 SASI_Hs01_00212169 predicted 522
10 SASI_Hs01_00212170 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020538 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102207 predicted 842
2 SASI_Rn02_00262556 predicted 251
3 SASI_Rn01_00102208 predicted 632
4 SASI_Rn01_00102209 predicted 376
5 SASI_Rn01_00102210 predicted 1014
6 SASI_Rn01_00102211 predicted 207
7 SASI_Rn01_00102212 predicted 1104
8 SASI_Rn01_00102213 predicted 881
9 SASI_Rn01_00102214 predicted 1136
10 SASI_Rn01_00102216 predicted 415
11 SASI_Rn01_00102215 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023383 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093243 predicted 413
2 SASI_Mm01_00093244 predicted 632
3 SASI_Mm01_00093245 predicted 980
4 SASI_Mm01_00093246 predicted 412
5 SASI_Mm01_00093247 predicted 1044
6 SASI_Mm01_00093248 predicted 269
7 SASI_Mm01_00093249 predicted 481
8 SASI_Mm01_00093250 predicted 1034
9 SASI_Mm02_00327085 predicted 915
10 SASI_Mm01_00093252 predicted 386
11 SASI_Mm01_00093251 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001086
VALIDATED
AADAC MISSION shRNA Bacterial Glycerol Stock
arylacetamide deacetylase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.1-1435s1c1
Sequence:CCGGCTGTGGGATTTCATTTCAATTCTCGAGAATTGAAATGAAATCCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.1-514s1c1
Sequence:CCGGCAACTACAGATTAGCACCTAACTCGAGTTAGGTGCTAATCTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.1-1061s1c1
Sequence:CCGGGACAACAAATTACGTGGCTTACTCGAGTAAGCCACGTAATTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.1-505s1c1
Sequence:CCGGCGTATCAACCAACTACAGATTCTCGAGAATCTGTAGTTGGTTGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.1-872s1c1
Sequence:CCGGGCCATGCTTTCCAGACAACATCTCGAGATGTTGTCTGGAAAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001086.2-273s1c1
Sequence:CCGGCTTTAAGGTTGTCGGGAGCTTCTCGAGAAGCTCCCGACAACCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.2-364s1c1
Sequence:CCGGCGGGTATATGTGCCAAAGAGACTCGAGTCTCTTTGGCACATATACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.2-877s1c1
Sequence:CCGGGCCATGCTTTCCAGACAACATCTCGAGATGTTGTCTGGAAAGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.2-682s1c1
Sequence:CCGGGTGACTCAACAGCTCCTTGATCTCGAGATCAAGGAGCTGTTGAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001086.2-192s1c1
Sequence:CCGGGTGGATAAACGCACATCTGAACTCGAGTTCAGATGTGCGTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.2-948s1c1
Sequence:CCGGGCTCCCTGAGAGGTTTATAAACTCGAGTTTATAAACCTCTCAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.2-519s1c1
Sequence:CCGGCAACTACAGATTAGCACCTAACTCGAGTTAGGTGCTAATCTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001086
VALIDATED
AADAC MISSION shRNA shRNA Plasmid DNA
arylacetamide deacetylase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.1-1435s1c1
Sequence:CCGGCTGTGGGATTTCATTTCAATTCTCGAGAATTGAAATGAAATCCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.1-514s1c1
Sequence:CCGGCAACTACAGATTAGCACCTAACTCGAGTTAGGTGCTAATCTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.1-1061s1c1
Sequence:CCGGGACAACAAATTACGTGGCTTACTCGAGTAAGCCACGTAATTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.1-505s1c1
Sequence:CCGGCGTATCAACCAACTACAGATTCTCGAGAATCTGTAGTTGGTTGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.1-872s1c1
Sequence:CCGGGCCATGCTTTCCAGACAACATCTCGAGATGTTGTCTGGAAAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001086.2-273s1c1
Sequence:CCGGCTTTAAGGTTGTCGGGAGCTTCTCGAGAAGCTCCCGACAACCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.2-364s1c1
Sequence:CCGGCGGGTATATGTGCCAAAGAGACTCGAGTCTCTTTGGCACATATACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.2-877s1c1
Sequence:CCGGGCCATGCTTTCCAGACAACATCTCGAGATGTTGTCTGGAAAGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.2-682s1c1
Sequence:CCGGGTGACTCAACAGCTCCTTGATCTCGAGATCAAGGAGCTGTTGAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001086.2-192s1c1
Sequence:CCGGGTGGATAAACGCACATCTGAACTCGAGTTCAGATGTGCGTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.2-948s1c1
Sequence:CCGGGCTCCCTGAGAGGTTTATAAACTCGAGTTTATAAACCTCTCAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.2-519s1c1
Sequence:CCGGCAACTACAGATTAGCACCTAACTCGAGTTAGGTGCTAATCTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001086
VALIDATED
AADAC MISSION shRNA Lentiviral Transduction Particles
arylacetamide deacetylase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.1-1435s1c1
Sequence:CCGGCTGTGGGATTTCATTTCAATTCTCGAGAATTGAAATGAAATCCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.1-514s1c1
Sequence:CCGGCAACTACAGATTAGCACCTAACTCGAGTTAGGTGCTAATCTGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.1-1061s1c1
Sequence:CCGGGACAACAAATTACGTGGCTTACTCGAGTAAGCCACGTAATTTGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.1-505s1c1
Sequence:CCGGCGTATCAACCAACTACAGATTCTCGAGAATCTGTAGTTGGTTGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.1-872s1c1
Sequence:CCGGGCCATGCTTTCCAGACAACATCTCGAGATGTTGTCTGGAAAGCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001086.2-273s1c1
Sequence:CCGGCTTTAAGGTTGTCGGGAGCTTCTCGAGAAGCTCCCGACAACCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.2-364s1c1
Sequence:CCGGCGGGTATATGTGCCAAAGAGACTCGAGTCTCTTTGGCACATATACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.2-877s1c1
Sequence:CCGGGCCATGCTTTCCAGACAACATCTCGAGATGTTGTCTGGAAAGCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.2-682s1c1
Sequence:CCGGGTGACTCAACAGCTCCTTGATCTCGAGATCAAGGAGCTGTTGAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153185    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001086.2-192s1c1
Sequence:CCGGGTGGATAAACGCACATCTGAACTCGAGTTCAGATGTGCGTTTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001086.2-948s1c1
Sequence:CCGGGCTCCCTGAGAGGTTTATAAACTCGAGTTTATAAACCTCTCAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001086.2-519s1c1
Sequence:CCGGCAACTACAGATTAGCACCTAACTCGAGTTAGGTGCTAATCTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023383
AADAC MISSION shRNA Bacterial Glycerol Stock
arylacetamide deacetylase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-286s1c1
Sequence:CCGGCGTCCGCATATACATACCCAACTCGAGTTGGGTATGTATATGCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-1032s1c1
Sequence:CCGGCTTGCCAGTATGATGTCCTAACTCGAGTTAGGACATCATACTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-104s1c1
Sequence:CCGGCCTTGGAAGGTAGTATGGGAACTCGAGTTCCCATACTACCTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-413s1c1
Sequence:CCGGGCCCATAAACTTGATGCTGTTCTCGAGAACAGCATCAAGTTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-874s1c1
Sequence:CCGGGCTCCCTGAGAGATACAAGAACTCGAGTTCTTGTATCTCTCAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023383
AADAC MISSION shRNA shRNA Plasmid DNA
arylacetamide deacetylase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-286s1c1
Sequence:CCGGCGTCCGCATATACATACCCAACTCGAGTTGGGTATGTATATGCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-1032s1c1
Sequence:CCGGCTTGCCAGTATGATGTCCTAACTCGAGTTAGGACATCATACTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-104s1c1
Sequence:CCGGCCTTGGAAGGTAGTATGGGAACTCGAGTTCCCATACTACCTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-413s1c1
Sequence:CCGGGCCCATAAACTTGATGCTGTTCTCGAGAACAGCATCAAGTTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-874s1c1
Sequence:CCGGGCTCCCTGAGAGATACAAGAACTCGAGTTCTTGTATCTCTCAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023383
AADAC MISSION shRNA Lentiviral Transduction Particles
arylacetamide deacetylase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-286s1c1
Sequence:CCGGCGTCCGCATATACATACCCAACTCGAGTTGGGTATGTATATGCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-1032s1c1
Sequence:CCGGCTTGCCAGTATGATGTCCTAACTCGAGTTAGGACATCATACTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-104s1c1
Sequence:CCGGCCTTGGAAGGTAGTATGGGAACTCGAGTTCCCATACTACCTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-413s1c1
Sequence:CCGGGCCCATAAACTTGATGCTGTTCTCGAGAACAGCATCAAGTTTATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023383.1-874s1c1
Sequence:CCGGGCTCCCTGAGAGATACAAGAACTCGAGTTCTTGTATCTCTCAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks