EMAIL THIS PAGE TO A FRIEND

AADACL2

arylacetamide deacetylase-like 2

62 Gene Product Result for
UniProtKB ID: Q6P093, Q5HYJ4
Gene ID:
Mouse(639634) arylacetamide deacetylase-like 2
Rat(295076) arylacetamide deacetylase-like 2
naked mole-rat(101705307) arylacetamide deacetylase-like 2
domestic guinea pig(100721639) arylacetamide deacetylase-like 2
chicken(425034) arylacetamide deacetylase-like 2
cow(528748) arylacetamide deacetylase-like 2
dog(609872) arylacetamide deacetylase-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207365 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001128091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001128091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001128091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022671 MISSION® esiRNA esiRNA human AADACL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207365 Rosetta Predictions human pricing
XM_001062198 Rosetta Predictions rat pricing
XM_227188 Rosetta Predictions rat pricing
NM_001128091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125694 predicted 231
2 SASI_Hs02_00373949 predicted 1019
3 SASI_Hs01_00125696 predicted 353
4 SASI_Hs01_00125697 predicted 698
5 SASI_Hs01_00125698 predicted 1146
6 SASI_Hs01_00125699 predicted 1260
7 SASI_Hs01_00125700 predicted 274
8 SASI_Hs01_00125701 predicted 1071
9 SASI_Hs01_00125703 predicted 925
10 SASI_Hs02_00373950 predicted 1212
11 SASI_Hs01_00125695 predicted 1116
12 SASI_Hs01_00125702 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302632 predicted 341
2 SASI_Rn02_00302633 predicted 526
3 SASI_Rn02_00302634 predicted 752
4 SASI_Rn02_00302635 predicted 533
5 SASI_Rn02_00302636 predicted 552
6 SASI_Rn02_00302637 predicted 833
7 SASI_Rn02_00302638 predicted 753
8 SASI_Rn02_00302639 predicted 462
9 SASI_Rn02_00302640 predicted 635
10 SASI_Rn02_00302641 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384156 predicted 344
2 SASI_Rn02_00384157 predicted 527
3 SASI_Rn02_00384158 predicted 753
4 SASI_Rn02_00384159 predicted 538
5 SASI_Rn02_00384160 predicted 549
6 SASI_Rn02_00384161 predicted 833
7 SASI_Rn02_00384162 predicted 746
8 SASI_Rn02_00384163 predicted 462
9 SASI_Rn02_00384164 predicted 635
10 SASI_Rn02_00384165 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310478 predicted 1181
2 SASI_Mm02_00310479 predicted 480
3 SASI_Mm02_00310480 predicted 1146
4 SASI_Mm02_00310481 predicted 823
5 SASI_Mm02_00310482 predicted 420
6 SASI_Mm02_00310483 predicted 1199
7 SASI_Mm02_00310484 predicted 444
8 SASI_Mm02_00310485 predicted 827
9 SASI_Mm02_00310486 predicted 427
10 SASI_Mm02_00310487 predicted 1206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207365
AADACL2 MISSION shRNA Bacterial Glycerol Stock
arylacetamide deacetylase-like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-494s1c1
Sequence:CCGGCCTGAATAGATGGACGGCAAACTCGAGTTTGCCGTCCATCTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-315s1c1
Sequence:CCGGCTGGATTATACCCAACCACTTCTCGAGAAGTGGTTGGGTATAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-1173s1c1
Sequence:CCGGCTTCGAAATGTTGGAGTCCAACTCGAGTTGGACTCCAACATTTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-860s1c1
Sequence:CCGGCGTGAGCTTATATTTCACCAACTCGAGTTGGTGAAATATAAGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207365.1-1342s1c1
Sequence:CCGGCCTTACATAGTGGATTGTAATCTCGAGATTACAATCCACTATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-759s1c1
Sequence:CCGGGTCTTACTTTACCCTGGCTTACTCGAGTAAGCCAGGGTAAAGTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-272s1c1
Sequence:CCGGGCGTATTATGAGATATGAAGACTCGAGTCTTCATATCTCATAATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-772s1c1
Sequence:CCGGCTGGCTTACAGATAACAGATTCTCGAGAATCTGTTATCTGTAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-1289s1c1
Sequence:CCGGGTATGTAAGTTGGCTGGATAACTCGAGTTATCCAGCCAACTTACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207365
AADACL2 MISSION shRNA shRNA Plasmid DNA
arylacetamide deacetylase-like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-494s1c1
Sequence:CCGGCCTGAATAGATGGACGGCAAACTCGAGTTTGCCGTCCATCTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-315s1c1
Sequence:CCGGCTGGATTATACCCAACCACTTCTCGAGAAGTGGTTGGGTATAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-1173s1c1
Sequence:CCGGCTTCGAAATGTTGGAGTCCAACTCGAGTTGGACTCCAACATTTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-860s1c1
Sequence:CCGGCGTGAGCTTATATTTCACCAACTCGAGTTGGTGAAATATAAGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207365.1-1342s1c1
Sequence:CCGGCCTTACATAGTGGATTGTAATCTCGAGATTACAATCCACTATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-759s1c1
Sequence:CCGGGTCTTACTTTACCCTGGCTTACTCGAGTAAGCCAGGGTAAAGTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-272s1c1
Sequence:CCGGGCGTATTATGAGATATGAAGACTCGAGTCTTCATATCTCATAATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-772s1c1
Sequence:CCGGCTGGCTTACAGATAACAGATTCTCGAGAATCTGTTATCTGTAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-1289s1c1
Sequence:CCGGGTATGTAAGTTGGCTGGATAACTCGAGTTATCCAGCCAACTTACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207365
AADACL2 MISSION shRNA Lentiviral Transduction Particles
arylacetamide deacetylase-like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-494s1c1
Sequence:CCGGCCTGAATAGATGGACGGCAAACTCGAGTTTGCCGTCCATCTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-315s1c1
Sequence:CCGGCTGGATTATACCCAACCACTTCTCGAGAAGTGGTTGGGTATAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-1173s1c1
Sequence:CCGGCTTCGAAATGTTGGAGTCCAACTCGAGTTGGACTCCAACATTTCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-860s1c1
Sequence:CCGGCGTGAGCTTATATTTCACCAACTCGAGTTGGTGAAATATAAGCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207365.1-1342s1c1
Sequence:CCGGCCTTACATAGTGGATTGTAATCTCGAGATTACAATCCACTATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161300    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-759s1c1
Sequence:CCGGGTCTTACTTTACCCTGGCTTACTCGAGTAAGCCAGGGTAAAGTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-272s1c1
Sequence:CCGGGCGTATTATGAGATATGAAGACTCGAGTCTTCATATCTCATAATACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-772s1c1
Sequence:CCGGCTGGCTTACAGATAACAGATTCTCGAGAATCTGTTATCTGTAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207365.1-1289s1c1
Sequence:CCGGGTATGTAAGTTGGCTGGATAACTCGAGTTATCCAGCCAACTTACATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128091
AADACL2 MISSION shRNA Bacterial Glycerol Stock
arylacetamide deacetylase-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-765s21c1
Sequence:CCGGGAGTAGATCCTACCCGAATTGCTCGAGCAATTCGGGTAGGATCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-1345s21c1
Sequence:CCGGCCACGGAGCCTTATCATATATCTCGAGATATATGATAAGGCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-958s21c1
Sequence:CCGGGACAAGGGACATAGCCATAAACTCGAGTTTATGGCTATGTCCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-1413s21c1
Sequence:CCGGATGTTAGTTGGCTGGATAATACTCGAGTATTATCCAGCCAACTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-543s21c1
Sequence:CCGGCAAGACGAGCTGTGATCTATTCTCGAGAATAGATCACAGCTCGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128091
AADACL2 MISSION shRNA shRNA Plasmid DNA
arylacetamide deacetylase-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-765s21c1
Sequence:CCGGGAGTAGATCCTACCCGAATTGCTCGAGCAATTCGGGTAGGATCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-1345s21c1
Sequence:CCGGCCACGGAGCCTTATCATATATCTCGAGATATATGATAAGGCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-958s21c1
Sequence:CCGGGACAAGGGACATAGCCATAAACTCGAGTTTATGGCTATGTCCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-1413s21c1
Sequence:CCGGATGTTAGTTGGCTGGATAATACTCGAGTATTATCCAGCCAACTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-543s21c1
Sequence:CCGGCAAGACGAGCTGTGATCTATTCTCGAGAATAGATCACAGCTCGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128091
AADACL2 MISSION shRNA Lentiviral Transduction Particles
arylacetamide deacetylase-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-765s21c1
Sequence:CCGGGAGTAGATCCTACCCGAATTGCTCGAGCAATTCGGGTAGGATCTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-1345s21c1
Sequence:CCGGCCACGGAGCCTTATCATATATCTCGAGATATATGATAAGGCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-958s21c1
Sequence:CCGGGACAAGGGACATAGCCATAAACTCGAGTTTATGGCTATGTCCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-1413s21c1
Sequence:CCGGATGTTAGTTGGCTGGATAATACTCGAGTATTATCCAGCCAACTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128091.1-543s21c1
Sequence:CCGGCAAGACGAGCTGTGATCTATTCTCGAGAATAGATCACAGCTCGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks