EMAIL THIS PAGE TO A FRIEND

AADACL3

arylacetamide deacetylase-like 3

81 Gene Product Result for
UniProtKB ID: Q5VUY0, B3KXR9, Q5VUY1
Gene ID:
Mouse(230883) arylacetamide deacetylase-like 3
Rat(313686) arylacetamide deacetylase-like 3
chicken(768668) arylacetamide deacetylase-like 4-like
dog(487435) arylacetamide deacetylase-like 3
domestic cat(101080902) arylacetamide deacetylase-like 3
domestic guinea pig(100735194) arylacetamide deacetylase-like 3
naked mole-rat(101706218) arylacetamide deacetylase-like 3
sheep(101112496) arylacetamide deacetylase-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001103169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001103169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001103169 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_144109 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_144109 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_144109 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU164511 MISSION® esiRNA esiRNA targeting mouse Aadacl3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001103169 Rosetta Predictions human pricing
NM_001103170 Rosetta Predictions human pricing
XM_928294 Rosetta Predictions human pricing
XR_000192 Rosetta Predictions human pricing
XM_001074227 Rosetta Predictions rat pricing
XM_233636 Rosetta Predictions rat pricing
NM_001085503 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323633 predicted 1125
2 SASI_Hs02_00323634 predicted 1009
3 SASI_Hs02_00323635 predicted 533
4 SASI_Hs02_00323636 predicted 432
5 SASI_Hs02_00323637 predicted 1202
6 SASI_Hs02_00323638 predicted 1192
7 SASI_Hs02_00323639 predicted 1218
8 SASI_Hs02_00323640 predicted 655
9 SASI_Hs02_00323641 predicted 513
10 SASI_Hs02_00323642 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323643 predicted 1345
2 SASI_Hs02_00323644 predicted 1217
3 SASI_Hs02_00323645 predicted 755
4 SASI_Hs02_00323646 predicted 646
5 SASI_Hs02_00323647 predicted 1420
6 SASI_Hs02_00323648 predicted 1405
7 SASI_Hs02_00323649 predicted 1435
8 SASI_Hs02_00323650 predicted 869
9 SASI_Hs02_00323651 predicted 725
10 SASI_Hs02_00323652 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299099 predicted 418
2 SASI_Hs01_00299100 predicted 283
3 SASI_Hs01_00299101 predicted 479
4 SASI_Hs01_00299102 predicted 281
5 SASI_Hs01_00299103 predicted 257
6 SASI_Hs01_00299104 predicted 266
7 SASI_Hs01_00299105 predicted 430
8 SASI_Hs01_00299106 predicted 353
9 SASI_Hs01_00299107 predicted 491
10 SASI_Hs01_00299108 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_000192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273963 predicted 534
2 SASI_Hs01_00273964 predicted 1653
3 SASI_Hs01_00273965 predicted 1429
4 SASI_Hs01_00273966 predicted 1197
5 SASI_Hs01_00273967 predicted 988
6 SASI_Hs01_00273968 predicted 1209
7 SASI_Hs01_00273969 predicted 305
8 SASI_Hs01_00273970 predicted 1685
9 SASI_Hs01_00273971 predicted 237
10 SASI_Hs01_00273972 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345473 predicted 633
2 SASI_Rn02_00345474 predicted 286
3 SASI_Rn02_00345475 predicted 840
4 SASI_Rn02_00345476 predicted 885
5 SASI_Rn02_00345477 predicted 458
6 SASI_Rn02_00345478 predicted 518
7 SASI_Rn02_00345479 predicted 332
8 SASI_Rn02_00345480 predicted 434
9 SASI_Rn02_00345481 predicted 263
10 SASI_Rn02_00345482 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387947 predicted 639
2 SASI_Rn02_00387948 predicted 281
3 SASI_Rn02_00387949 predicted 844
4 SASI_Rn02_00387950 predicted 879
5 SASI_Rn02_00387951 predicted 462
6 SASI_Rn02_00387952 predicted 524
7 SASI_Rn02_00387953 predicted 327
8 SASI_Rn02_00387954 predicted 437
9 SASI_Rn02_00387955 predicted 261
10 SASI_Rn02_00387956 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300612 predicted 1275
2 SASI_Mm02_00300613 predicted 1156
3 SASI_Mm02_00300614 predicted 822
4 SASI_Mm02_00300615 predicted 268
5 SASI_Mm02_00300616 predicted 1077
6 SASI_Mm02_00300617 predicted 955
7 SASI_Mm02_00300618 predicted 1209
8 SASI_Mm02_00300619 predicted 548
9 SASI_Mm02_00300620 predicted 689
10 SASI_Mm02_00300621 predicted 944
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085503
AADACL3 MISSION shRNA Bacterial Glycerol Stock
arylacetamide deacetylase-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085503.2-160s21c1
Sequence:CCGGCGAATCCTCAGTTGCTTATTTCTCGAGAAATAAGCAACTGAGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085503.2-1173s21c1
Sequence:CCGGTGCCCTTGACTATGGATTATTCTCGAGAATAATCCATAGTCAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085503.2-1213s21c1
Sequence:CCGGAGAATTATGGACCTGATTATTCTCGAGAATAATCAGGTCCATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085503.2-1078s21c1
Sequence:CCGGCGGGACCATTCTCTCTTATATCTCGAGATATAAGAGAGAATGGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085503.2-1283s21c1
Sequence:CCGGCCAACCTAGTCTGGATTATAACTCGAGTTATAATCCAGACTAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085503
AADACL3 MISSION shRNA shRNA Plasmid DNA
arylacetamide deacetylase-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085503.2-160s21c1
Sequence:CCGGCGAATCCTCAGTTGCTTATTTCTCGAGAAATAAGCAACTGAGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085503.2-1173s21c1
Sequence:CCGGTGCCCTTGACTATGGATTATTCTCGAGAATAATCCATAGTCAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085503.2-1213s21c1
Sequence:CCGGAGAATTATGGACCTGATTATTCTCGAGAATAATCAGGTCCATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085503.2-1078s21c1
Sequence:CCGGCGGGACCATTCTCTCTTATATCTCGAGATATAAGAGAGAATGGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085503.2-1283s21c1
Sequence:CCGGCCAACCTAGTCTGGATTATAACTCGAGTTATAATCCAGACTAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085503
AADACL3 MISSION shRNA Lentiviral Transduction Particles
arylacetamide deacetylase-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085503.2-160s21c1
Sequence:CCGGCGAATCCTCAGTTGCTTATTTCTCGAGAAATAAGCAACTGAGGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085503.2-1173s21c1
Sequence:CCGGTGCCCTTGACTATGGATTATTCTCGAGAATAATCCATAGTCAAGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085503.2-1213s21c1
Sequence:CCGGAGAATTATGGACCTGATTATTCTCGAGAATAATCAGGTCCATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085503.2-1078s21c1
Sequence:CCGGCGGGACCATTCTCTCTTATATCTCGAGATATAAGAGAGAATGGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085503.2-1283s21c1
Sequence:CCGGCCAACCTAGTCTGGATTATAACTCGAGTTATAATCCAGACTAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001103169
AADACL3 MISSION shRNA Bacterial Glycerol Stock
arylacetamide deacetylase-like 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103169.1-644s21c1
Sequence:CCGGATCATGAAAGGTGCCCATTTGCTCGAGCAAATGGGCACCTTTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103169.1-2400s21c1
Sequence:CCGGTAATTGAAGGGTAGGGTAAATCTCGAGATTTACCCTACCCTTCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103169.1-882s21c1
Sequence:CCGGATGATGCTCTCCGGGACAATTCTCGAGAATTGTCCCGGAGAGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103169.1-1034s21c1
Sequence:CCGGCTGAGTGCATTAGTTCAATTTCTCGAGAAATTGAACTAATGCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103169.1-298s21c1
Sequence:CCGGCCGCAAGTTACCTAAGCATAACTCGAGTTATGCTTAGGTAACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001103169
AADACL3 MISSION shRNA shRNA Plasmid DNA
arylacetamide deacetylase-like 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103169.1-644s21c1
Sequence:CCGGATCATGAAAGGTGCCCATTTGCTCGAGCAAATGGGCACCTTTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103169.1-2400s21c1
Sequence:CCGGTAATTGAAGGGTAGGGTAAATCTCGAGATTTACCCTACCCTTCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103169.1-882s21c1
Sequence:CCGGATGATGCTCTCCGGGACAATTCTCGAGAATTGTCCCGGAGAGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103169.1-1034s21c1
Sequence:CCGGCTGAGTGCATTAGTTCAATTTCTCGAGAAATTGAACTAATGCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103169.1-298s21c1
Sequence:CCGGCCGCAAGTTACCTAAGCATAACTCGAGTTATGCTTAGGTAACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001103169
AADACL3 MISSION shRNA Lentiviral Transduction Particles
arylacetamide deacetylase-like 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103169.1-644s21c1
Sequence:CCGGATCATGAAAGGTGCCCATTTGCTCGAGCAAATGGGCACCTTTCATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001103169.1-2400s21c1
Sequence:CCGGTAATTGAAGGGTAGGGTAAATCTCGAGATTTACCCTACCCTTCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103169.1-882s21c1
Sequence:CCGGATGATGCTCTCCGGGACAATTCTCGAGAATTGTCCCGGAGAGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103169.1-1034s21c1
Sequence:CCGGCTGAGTGCATTAGTTCAATTTCTCGAGAAATTGAACTAATGCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001103169.1-298s21c1
Sequence:CCGGCCGCAAGTTACCTAAGCATAACTCGAGTTATGCTTAGGTAACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_144109
AADACL3 MISSION shRNA Bacterial Glycerol Stock
arylacetamide deacetylase-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-1051s1c1
Sequence:CCGGCGGGACCATTCTCTCTTATATCTCGAGATATAAGAGAGAATGGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-481s1c1
Sequence:CCGGCCAGTGATGAAAGATGACTGTCTCGAGACAGTCATCTTTCATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-701s1c1
Sequence:CCGGCCTCTTATCAACAGAATAGAACTCGAGTTCTATTCTGTTGATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-143s1c1
Sequence:CCGGGTTGCTTATTTCATCTGACAACTCGAGTTGTCAGATGAAATAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-700s1c1
Sequence:CCGGCCCTCTTATCAACAGAATAGACTCGAGTCTATTCTGTTGATAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_144109
AADACL3 MISSION shRNA shRNA Plasmid DNA
arylacetamide deacetylase-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-1051s1c1
Sequence:CCGGCGGGACCATTCTCTCTTATATCTCGAGATATAAGAGAGAATGGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-481s1c1
Sequence:CCGGCCAGTGATGAAAGATGACTGTCTCGAGACAGTCATCTTTCATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-701s1c1
Sequence:CCGGCCTCTTATCAACAGAATAGAACTCGAGTTCTATTCTGTTGATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-143s1c1
Sequence:CCGGGTTGCTTATTTCATCTGACAACTCGAGTTGTCAGATGAAATAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-700s1c1
Sequence:CCGGCCCTCTTATCAACAGAATAGACTCGAGTCTATTCTGTTGATAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_144109
AADACL3 MISSION shRNA Lentiviral Transduction Particles
arylacetamide deacetylase-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-1051s1c1
Sequence:CCGGCGGGACCATTCTCTCTTATATCTCGAGATATAAGAGAGAATGGTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-481s1c1
Sequence:CCGGCCAGTGATGAAAGATGACTGTCTCGAGACAGTCATCTTTCATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-701s1c1
Sequence:CCGGCCTCTTATCAACAGAATAGAACTCGAGTTCTATTCTGTTGATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185518    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-143s1c1
Sequence:CCGGGTTGCTTATTTCATCTGACAACTCGAGTTGTCAGATGAAATAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_144109.1-700s1c1
Sequence:CCGGCCCTCTTATCAACAGAATAGACTCGAGTCTATTCTGTTGATAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks