EMAIL THIS PAGE TO A FRIEND

AADACL4

arylacetamide deacetylase-like 4

42 Gene Product Result for
UniProtKB ID: Q5VUY2
Gene ID:
Rat(313688) arylacetamide deacetylase-like 4
sheep(101110780) arylacetamide deacetylase-like 4
naked mole-rat(101706585) arylacetamide deacetylase-like 4
domestic guinea pig(100713568) arylacetamide deacetylase-like 4
Zebrafish(569798) arylacetamide deacetylase-like 4
cow(529424) arylacetamide deacetylase-like 4
domestic cat(101080646) arylacetamide deacetylase-like 4
dog(607688) arylacetamide deacetylase-like 4
chicken(419479) arylacetamide deacetylase-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013630 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013630 Rosetta Predictions human pricing
XM_001074331 Rosetta Predictions rat pricing
XM_233640 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061372 predicted 388
2 SASI_Hs01_00061373 predicted 720
3 SASI_Hs01_00061374 predicted 400
4 SASI_Hs02_00306403 predicted 216
5 SASI_Hs01_00061375 predicted 246
6 SASI_Hs01_00061376 predicted 419
7 SASI_Hs01_00061377 predicted 424
8 SASI_Hs01_00061378 predicted 722
9 SASI_Hs01_00061379 predicted 1170
10 SASI_Hs01_00061380 predicted 923
11 SASI_Hs01_00061381 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345819 predicted 741
2 SASI_Rn02_00345820 predicted 777
3 SASI_Rn02_00345821 predicted 660
4 SASI_Rn02_00345822 predicted 219
5 SASI_Rn02_00345823 predicted 253
6 SASI_Rn02_00345824 predicted 729
7 SASI_Rn02_00345825 predicted 840
8 SASI_Rn02_00345826 predicted 773
9 SASI_Rn02_00345827 predicted 469
10 SASI_Rn02_00345828 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387957 predicted 742
2 SASI_Rn02_00387958 predicted 780
3 SASI_Rn02_00387959 predicted 664
4 SASI_Rn02_00387960 predicted 215
5 SASI_Rn02_00387961 predicted 255
6 SASI_Rn02_00387962 predicted 732
7 SASI_Rn02_00387963 predicted 844
8 SASI_Rn02_00387964 predicted 476
9 SASI_Rn02_00387965 predicted 961
10 SASI_Rn02_00387966 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013630
AADACL4 MISSION shRNA Bacterial Glycerol Stock
arylacetamide deacetylase-like 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013630.1-1279s1c1
Sequence:CCGGCGGGTGCTTTAGTGAGTTCTACTCGAGTAGAACTCACTAAAGCACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013630.1-114s1c1
Sequence:CCGGGCATCCTGCCAAGTTGAGATTCTCGAGAATCTCAACTTGGCAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013630.1-183s1c1
Sequence:CCGGGAAGCTGGGAATTTGCTCCATCTCGAGATGGAGCAAATTCCCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013630.1-943s1c1
Sequence:CCGGGCCAAACATATGCTGGATGTACTCGAGTACATCCAGCATATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013630.1-1357s1c1
Sequence:CCGGGTAAGCTAACAGTCTTGCTTACTCGAGTAAGCAAGACTGTTAGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013630.1-1361s1c1
Sequence:CCGGGCTAACAGTCTTGCTTAGTATCTCGAGATACTAAGCAAGACTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013630.1-200s1c1
Sequence:CCGGCCATGCCCAAATTTATTCGTTCTCGAGAACGAATAAATTTGGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013630.1-1413s1c1
Sequence:CCGGCCAGCACTAACAATGTCCATTCTCGAGAATGGACATTGTTAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013630.1-940s1c1
Sequence:CCGGGAAGCCAAACATATGCTGGATCTCGAGATCCAGCATATGTTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013630.1-122s1c1
Sequence:CCGGCCAAGTTGAGATTCCTGCATTCTCGAGAATGCAGGAATCTCAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013630
AADACL4 MISSION shRNA shRNA Plasmid DNA
arylacetamide deacetylase-like 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013630.1-1279s1c1
Sequence:CCGGCGGGTGCTTTAGTGAGTTCTACTCGAGTAGAACTCACTAAAGCACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013630.1-114s1c1
Sequence:CCGGGCATCCTGCCAAGTTGAGATTCTCGAGAATCTCAACTTGGCAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013630.1-183s1c1
Sequence:CCGGGAAGCTGGGAATTTGCTCCATCTCGAGATGGAGCAAATTCCCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013630.1-943s1c1
Sequence:CCGGGCCAAACATATGCTGGATGTACTCGAGTACATCCAGCATATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013630.1-1357s1c1
Sequence:CCGGGTAAGCTAACAGTCTTGCTTACTCGAGTAAGCAAGACTGTTAGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013630.1-1361s1c1
Sequence:CCGGGCTAACAGTCTTGCTTAGTATCTCGAGATACTAAGCAAGACTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013630.1-200s1c1
Sequence:CCGGCCATGCCCAAATTTATTCGTTCTCGAGAACGAATAAATTTGGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013630.1-1413s1c1
Sequence:CCGGCCAGCACTAACAATGTCCATTCTCGAGAATGGACATTGTTAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013630.1-940s1c1
Sequence:CCGGGAAGCCAAACATATGCTGGATCTCGAGATCCAGCATATGTTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013630.1-122s1c1
Sequence:CCGGCCAAGTTGAGATTCCTGCATTCTCGAGAATGCAGGAATCTCAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013630
AADACL4 MISSION shRNA Lentiviral Transduction Particles
arylacetamide deacetylase-like 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155362    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013630.1-1279s1c1
Sequence:CCGGCGGGTGCTTTAGTGAGTTCTACTCGAGTAGAACTCACTAAAGCACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013630.1-114s1c1
Sequence:CCGGGCATCCTGCCAAGTTGAGATTCTCGAGAATCTCAACTTGGCAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154545    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013630.1-183s1c1
Sequence:CCGGGAAGCTGGGAATTTGCTCCATCTCGAGATGGAGCAAATTCCCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013630.1-943s1c1
Sequence:CCGGGCCAAACATATGCTGGATGTACTCGAGTACATCCAGCATATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150666    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013630.1-1357s1c1
Sequence:CCGGGTAAGCTAACAGTCTTGCTTACTCGAGTAAGCAAGACTGTTAGCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013630.1-1361s1c1
Sequence:CCGGGCTAACAGTCTTGCTTAGTATCTCGAGATACTAAGCAAGACTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013630.1-200s1c1
Sequence:CCGGCCATGCCCAAATTTATTCGTTCTCGAGAACGAATAAATTTGGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013630.1-1413s1c1
Sequence:CCGGCCAGCACTAACAATGTCCATTCTCGAGAATGGACATTGTTAGTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013630.1-940s1c1
Sequence:CCGGGAAGCCAAACATATGCTGGATCTCGAGATCCAGCATATGTTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013630.1-122s1c1
Sequence:CCGGCCAAGTTGAGATTCCTGCATTCTCGAGAATGCAGGAATCTCAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks