EMAIL THIS PAGE TO A FRIEND

AADAT

aminoadipate aminotransferase

96 Gene Product Result for
Synonyms: KAT2 KATII
UniProtKB ID: Q8N5Z0, B3KP84, Q9UL02
Gene ID:
Human(51166) Summary: This gene encodes a protein that is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccaropine pathway which is the major pathway for L-lysine catabolism. The other activity involves the transamination of kynurenine to produce kynurenine acid, the precursor of kynurenic acid which has neuroprotective properties. Two alternative transcripts encoding the same isoform have been identified, however, additional alternative transcripts and isoforms may exist. [provided by RefSeq, Jul 2008]
Mouse(23923) aminoadipate aminotransferase
Rat(29416) aminoadipate aminotransferase
chicken(428728) aminoadipate aminotransferase
cow(508929) aminoadipate aminotransferase
domestic cat(101091616) aminoadipate aminotransferase
dog(486059) aminoadipate aminotransferase
naked mole-rat(101707012) aminoadipate aminotransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016228 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016228 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016228 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071611 MISSION® esiRNA esiRNA human AADAT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016228 Rosetta Predictions human pricing
NM_182662 Rosetta Predictions human pricing
NM_017193 Rosetta Predictions rat pricing
NM_011834 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083940 predicted 828
2 SASI_Hs01_00083941 predicted 644
3 SASI_Hs01_00083942 predicted 740
4 SASI_Hs01_00083943 predicted 1240
5 SASI_Hs01_00083945 predicted 1051
6 SASI_Hs01_00083946 predicted 1172
7 SASI_Hs01_00083948 predicted 634
8 SASI_Hs01_00083949 predicted 670
9 SASI_Hs02_00349094 predicted 557
10 SASI_Hs02_00349095 predicted 974
11 SASI_Hs01_00083944 predicted 731
12 SASI_Hs01_00083947 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083320 predicted 617
2 SASI_Hs01_00083321 predicted 432
3 SASI_Hs01_00083322 predicted 531
4 SASI_Hs01_00083323 predicted 1026
5 SASI_Hs01_00083325 predicted 834
6 SASI_Hs01_00083326 predicted 959
7 SASI_Hs01_00083328 predicted 418
8 SASI_Hs01_00083329 predicted 445
9 SASI_Hs02_00370818 predicted 342
10 SASI_Hs02_00370819 predicted 763
11 SASI_Hs01_00083324 predicted 511
12 SASI_Hs01_00083327 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067911 predicted 321
2 SASI_Rn01_00067912 predicted 1458
3 SASI_Rn01_00067913 predicted 1223
4 SASI_Rn01_00067914 predicted 341
5 SASI_Rn01_00067915 predicted 707
6 SASI_Rn01_00067916 predicted 1160
7 SASI_Rn01_00067917 predicted 1246
8 SASI_Rn01_00067918 predicted 509
9 SASI_Rn01_00067919 predicted 957
10 SASI_Rn01_00067920 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194709 predicted 1236
2 SASI_Mm02_00321551 predicted 678
3 SASI_Mm01_00194710 predicted 1331
4 SASI_Mm01_00194711 predicted 897
5 SASI_Mm01_00194712 predicted 842
6 SASI_Mm01_00194713 predicted 1206
7 SASI_Mm01_00194714 predicted 1138
8 SASI_Mm01_00194715 predicted 298
9 SASI_Mm01_00194716 predicted 1166
10 SASI_Mm01_00194717 predicted 770
11 SASI_Mm01_00194718 predicted 1043
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016228
AADAT MISSION shRNA Bacterial Glycerol Stock
aminoadipate aminotransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-1527s1c1
Sequence:CCGGCCCTTACTTGAGAGCATCCTTCTCGAGAAGGATGCTCTCAAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-1177s1c1
Sequence:CCGGCCCTTAATAGAGAGAGTTATTCTCGAGAATAACTCTCTCTATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-820s1c1
Sequence:CCGGGCCAGTGATGAAAGTGGGATTCTCGAGAATCCCACTTTCATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-399s1c1
Sequence:CCGGCCGGACCATGACTGACATATTCTCGAGAATATGTCAGTCATGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-1584s1c1
Sequence:CCGGCCAGGTATTAGCACAACTTATCTCGAGATAAGTTGTGCTAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-1177s21c1
Sequence:CCGGCCCTTAATAGAGAGAGTTATTCTCGAGAATAACTCTCTCTATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-820s21c1
Sequence:CCGGGCCAGTGATGAAAGTGGGATTCTCGAGAATCCCACTTTCATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-399s21c1
Sequence:CCGGCCGGACCATGACTGACATATTCTCGAGAATATGTCAGTCATGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-1527s21c1
Sequence:CCGGCCCTTACTTGAGAGCATCCTTCTCGAGAAGGATGCTCTCAAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-1584s21c1
Sequence:CCGGCCAGGTATTAGCACAACTTATCTCGAGATAAGTTGTGCTAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016228
AADAT MISSION shRNA shRNA Plasmid DNA
aminoadipate aminotransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-1527s1c1
Sequence:CCGGCCCTTACTTGAGAGCATCCTTCTCGAGAAGGATGCTCTCAAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-1177s1c1
Sequence:CCGGCCCTTAATAGAGAGAGTTATTCTCGAGAATAACTCTCTCTATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-820s1c1
Sequence:CCGGGCCAGTGATGAAAGTGGGATTCTCGAGAATCCCACTTTCATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-399s1c1
Sequence:CCGGCCGGACCATGACTGACATATTCTCGAGAATATGTCAGTCATGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-1584s1c1
Sequence:CCGGCCAGGTATTAGCACAACTTATCTCGAGATAAGTTGTGCTAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-1177s21c1
Sequence:CCGGCCCTTAATAGAGAGAGTTATTCTCGAGAATAACTCTCTCTATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-820s21c1
Sequence:CCGGGCCAGTGATGAAAGTGGGATTCTCGAGAATCCCACTTTCATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-399s21c1
Sequence:CCGGCCGGACCATGACTGACATATTCTCGAGAATATGTCAGTCATGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-1527s21c1
Sequence:CCGGCCCTTACTTGAGAGCATCCTTCTCGAGAAGGATGCTCTCAAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-1584s21c1
Sequence:CCGGCCAGGTATTAGCACAACTTATCTCGAGATAAGTTGTGCTAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016228
AADAT MISSION shRNA Lentiviral Transduction Particles
aminoadipate aminotransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-1527s1c1
Sequence:CCGGCCCTTACTTGAGAGCATCCTTCTCGAGAAGGATGCTCTCAAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-1177s1c1
Sequence:CCGGCCCTTAATAGAGAGAGTTATTCTCGAGAATAACTCTCTCTATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-820s1c1
Sequence:CCGGGCCAGTGATGAAAGTGGGATTCTCGAGAATCCCACTTTCATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-399s1c1
Sequence:CCGGCCGGACCATGACTGACATATTCTCGAGAATATGTCAGTCATGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016228.3-1584s1c1
Sequence:CCGGCCAGGTATTAGCACAACTTATCTCGAGATAAGTTGTGCTAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-1177s21c1
Sequence:CCGGCCCTTAATAGAGAGAGTTATTCTCGAGAATAACTCTCTCTATTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-820s21c1
Sequence:CCGGGCCAGTGATGAAAGTGGGATTCTCGAGAATCCCACTTTCATCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-399s21c1
Sequence:CCGGCCGGACCATGACTGACATATTCTCGAGAATATGTCAGTCATGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-1527s21c1
Sequence:CCGGCCCTTACTTGAGAGCATCCTTCTCGAGAAGGATGCTCTCAAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016228.3-1584s21c1
Sequence:CCGGCCAGGTATTAGCACAACTTATCTCGAGATAAGTTGTGCTAATACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011834
AADAT MISSION shRNA Bacterial Glycerol Stock
aminoadipate aminotransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011834.1-917s1c1
Sequence:CCGGCCCTAAGACCTTGATACAGAACTCGAGTTCTGTATCAAGGTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011834.1-1574s1c1
Sequence:CCGGGCAACTGACAAAGCATTAAATCTCGAGATTTAATGCTTTGTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011834.1-1038s1c1
Sequence:CCGGGCTCATATTGACAGAACTATTCTCGAGAATAGTTCTGTCAATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011834.1-918s1c1
Sequence:CCGGCCTAAGACCTTGATACAGAATCTCGAGATTCTGTATCAAGGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011834.1-272s1c1
Sequence:CCGGCCGGTTTGAAGACGACTTGATCTCGAGATCAAGTCGTCTTCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011834
AADAT MISSION shRNA shRNA Plasmid DNA
aminoadipate aminotransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011834.1-917s1c1
Sequence:CCGGCCCTAAGACCTTGATACAGAACTCGAGTTCTGTATCAAGGTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011834.1-1574s1c1
Sequence:CCGGGCAACTGACAAAGCATTAAATCTCGAGATTTAATGCTTTGTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011834.1-1038s1c1
Sequence:CCGGGCTCATATTGACAGAACTATTCTCGAGAATAGTTCTGTCAATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011834.1-918s1c1
Sequence:CCGGCCTAAGACCTTGATACAGAATCTCGAGATTCTGTATCAAGGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011834.1-272s1c1
Sequence:CCGGCCGGTTTGAAGACGACTTGATCTCGAGATCAAGTCGTCTTCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011834
AADAT MISSION shRNA Lentiviral Transduction Particles
aminoadipate aminotransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011834.1-917s1c1
Sequence:CCGGCCCTAAGACCTTGATACAGAACTCGAGTTCTGTATCAAGGTCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119802    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011834.1-1574s1c1
Sequence:CCGGGCAACTGACAAAGCATTAAATCTCGAGATTTAATGCTTTGTCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011834.1-1038s1c1
Sequence:CCGGGCTCATATTGACAGAACTATTCTCGAGAATAGTTCTGTCAATATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011834.1-918s1c1
Sequence:CCGGCCTAAGACCTTGATACAGAATCTCGAGATTCTGTATCAAGGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011834.1-272s1c1
Sequence:CCGGCCGGTTTGAAGACGACTTGATCTCGAGATCAAGTCGTCTTCAAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks