EMAIL THIS PAGE TO A FRIEND

AAED1

AhpC/TSA antioxidant enzyme domain containing 1

46 Gene Product Result for
Synonyms: C9orf21
UniProtKB ID: Q7RTV5, B2RMW4, Q5JU02
Gene ID:
Mouse(66129) AhpC/TSA antioxidant enzyme domain containing 1
Rat(498685) AhpC/TSA antioxidant enzyme domain containing 1
domestic cat(101089903) AhpC/TSA antioxidant enzyme domain containing 1
cow(616897) AhpC/TSA antioxidant enzyme domain containing 1
dog(606835) AhpC/TSA antioxidant enzyme domain containing 1
naked mole-rat(101712714) AhpC/TSA antioxidant enzyme domain containing 1
domestic guinea pig(100727764) AhpC/TSA antioxidant enzyme domain containing 1
sheep(101110648) AhpC/TSA antioxidant enzyme domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153698 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110851 MISSION® esiRNA esiRNA human C9orf21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153698 Rosetta Predictions human pricing
NM_001109114 Rosetta Predictions rat pricing
NM_025370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367413 predicted 321
2 SASI_Hs01_00092038 predicted 384
3 SASI_Hs01_00092039 predicted 624
4 SASI_Hs01_00092040 predicted 612
5 SASI_Hs01_00092041 predicted 233
6 SASI_Hs01_00092042 predicted 221
7 SASI_Hs01_00092043 predicted 611
8 SASI_Hs01_00092044 predicted 612
9 SASI_Hs01_00092045 predicted 307
10 SASI_Hs01_00092046 predicted 381
11 SASI_Hs01_00092037 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245260 predicted 310
2 SASI_Rn02_00245261 predicted 247
3 SASI_Rn02_00245262 predicted 454
4 SASI_Rn02_00245263 predicted 462
5 SASI_Rn02_00245264 predicted 355
6 SASI_Rn02_00245265 predicted 406
7 SASI_Rn02_00245266 predicted 403
8 SASI_Rn02_00245267 predicted 462
9 SASI_Rn02_00245268 predicted 477
10 SASI_Rn02_00245269 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190051 predicted 611
2 SASI_Mm01_00190052 predicted 220
3 SASI_Mm02_00328089 predicted 344
4 SASI_Mm01_00190054 predicted 576
5 SASI_Mm01_00190055 predicted 546
6 SASI_Mm01_00190056 predicted 610
7 SASI_Mm01_00190057 predicted 201
8 SASI_Mm01_00190058 predicted 283
9 SASI_Mm01_00190059 predicted 686
10 SASI_Mm01_00190060 predicted 377
11 SASI_Mm01_00190053 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025370
VALIDATED
AAED1 MISSION shRNA Bacterial Glycerol Stock
AhpC/TSA antioxidant enzyme domain containing 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025370.2-234s21c1
Sequence:CCGGGTCTGTAAAGAATATGTCGAACTCGAGTTCGACATATTCTTTACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025370.2-784s21c1
Sequence:CCGGGCTATGAAACACAGAACTTATCTCGAGATAAGTTCTGTGTTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025370.2-576s21c1
Sequence:CCGGCCAGGTAACAACATCCACTTTCTCGAGAAAGTGGATGTTGTTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025370.2-316s21c1
Sequence:CCGGGACAATCATCATACCATCATACTCGAGTATGATGGTATGATGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025370.1-604s1c1
Sequence:CCGGCGAGACAGGAATAGGTTGGATCTCGAGATCCAACCTATTCCTGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025370.1-577s1c1
Sequence:CCGGCCAGGTAACAACATCCACTTTCTCGAGAAAGTGGATGTTGTTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025370.1-326s1c1
Sequence:CCGGCATACCATCATATTGAGCCTTCTCGAGAAGGCTCAATATGATGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025370.1-317s1c1
Sequence:CCGGGACAATCATCATACCATCATACTCGAGTATGATGGTATGATGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025370.1-234s1c1
Sequence:CCGGCGTCTGTAAAGAATATGTCGACTCGAGTCGACATATTCTTTACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025370.1-343s1c1
Sequence:CCGGCCTTTCTGCAAACTGACTGGACTCGAGTCCAGTCAGTTTGCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025370.1-235s1c1
Sequence:CCGGGTCTGTAAAGAATATGTCGAACTCGAGTTCGACATATTCTTTACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176962    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025370.1-785s1c1
Sequence:CCGGGCTATGAAACACAGAACTTATCTCGAGATAAGTTCTGTGTTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025370
VALIDATED
AAED1 MISSION shRNA shRNA Plasmid DNA
AhpC/TSA antioxidant enzyme domain containing 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025370.2-234s21c1
Sequence:CCGGGTCTGTAAAGAATATGTCGAACTCGAGTTCGACATATTCTTTACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025370.2-784s21c1
Sequence:CCGGGCTATGAAACACAGAACTTATCTCGAGATAAGTTCTGTGTTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025370.2-576s21c1
Sequence:CCGGCCAGGTAACAACATCCACTTTCTCGAGAAAGTGGATGTTGTTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025370.2-316s21c1
Sequence:CCGGGACAATCATCATACCATCATACTCGAGTATGATGGTATGATGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025370.1-604s1c1
Sequence:CCGGCGAGACAGGAATAGGTTGGATCTCGAGATCCAACCTATTCCTGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025370.1-577s1c1
Sequence:CCGGCCAGGTAACAACATCCACTTTCTCGAGAAAGTGGATGTTGTTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025370.1-326s1c1
Sequence:CCGGCATACCATCATATTGAGCCTTCTCGAGAAGGCTCAATATGATGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025370.1-317s1c1
Sequence:CCGGGACAATCATCATACCATCATACTCGAGTATGATGGTATGATGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025370.1-234s1c1
Sequence:CCGGCGTCTGTAAAGAATATGTCGACTCGAGTCGACATATTCTTTACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025370.1-343s1c1
Sequence:CCGGCCTTTCTGCAAACTGACTGGACTCGAGTCCAGTCAGTTTGCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025370.1-235s1c1
Sequence:CCGGGTCTGTAAAGAATATGTCGAACTCGAGTTCGACATATTCTTTACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176962    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025370.1-785s1c1
Sequence:CCGGGCTATGAAACACAGAACTTATCTCGAGATAAGTTCTGTGTTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025370
VALIDATED
AAED1 MISSION shRNA Lentiviral Transduction Particles
AhpC/TSA antioxidant enzyme domain containing 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025370.2-234s21c1
Sequence:CCGGGTCTGTAAAGAATATGTCGAACTCGAGTTCGACATATTCTTTACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025370.2-784s21c1
Sequence:CCGGGCTATGAAACACAGAACTTATCTCGAGATAAGTTCTGTGTTTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025370.2-576s21c1
Sequence:CCGGCCAGGTAACAACATCCACTTTCTCGAGAAAGTGGATGTTGTTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025370.2-316s21c1
Sequence:CCGGGACAATCATCATACCATCATACTCGAGTATGATGGTATGATGATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200147    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025370.1-604s1c1
Sequence:CCGGCGAGACAGGAATAGGTTGGATCTCGAGATCCAACCTATTCCTGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025370.1-577s1c1
Sequence:CCGGCCAGGTAACAACATCCACTTTCTCGAGAAAGTGGATGTTGTTACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025370.1-326s1c1
Sequence:CCGGCATACCATCATATTGAGCCTTCTCGAGAAGGCTCAATATGATGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025370.1-317s1c1
Sequence:CCGGGACAATCATCATACCATCATACTCGAGTATGATGGTATGATGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025370.1-234s1c1
Sequence:CCGGCGTCTGTAAAGAATATGTCGACTCGAGTCGACATATTCTTTACAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182248    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025370.1-343s1c1
Sequence:CCGGCCTTTCTGCAAACTGACTGGACTCGAGTCCAGTCAGTTTGCAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025370.1-235s1c1
Sequence:CCGGGTCTGTAAAGAATATGTCGAACTCGAGTTCGACATATTCTTTACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176962    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025370.1-785s1c1
Sequence:CCGGGCTATGAAACACAGAACTTATCTCGAGATAAGTTCTGTGTTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153698
VALIDATED
AAED1 MISSION shRNA Bacterial Glycerol Stock
AhpC/TSA antioxidant enzyme domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153698.1-225s1c1
Sequence:CCGGGCGGCATTTCCTGTGTTACATCTCGAGATGTAACACAGGAAATGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-613s1c1
Sequence:CCGGCGCGATAGGAATAGGTTGGATCTCGAGATCCAACCTATTCCTATCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153698.1-658s1c1
Sequence:CCGGCAGCTTGTAGGAGTTCAGCATCTCGAGATGCTGAACTCCTACAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-237s1c1
Sequence:CCGGGTGTTACATCTGCAAGGAATACTCGAGTATTCCTTGCAGATGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153698.1-295s1c1
Sequence:CCGGCAAGAAGCAAATGTCACCCTTCTCGAGAAGGGTGACATTTGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153698.1-827s1c1
Sequence:CCGGGAGGAGTTAGGGAAGCATAAACTCGAGTTTATGCTTCCCTAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-336s1c1
Sequence:CCGGCTACCATCATATTGAGCCTTTCTCGAGAAAGGCTCAATATGATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-668s1c1
Sequence:CCGGGAGTTCAGCATGTGAACTTTACTCGAGTAAAGTTCACATGCTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153698.1-393s1c1
Sequence:CCGGCGATCCTGAGAGAGAAATTTACTCGAGTAAATTTCTCTCTCAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-1077s1c1
Sequence:CCGGGAGAACAACACAAGACCATTACTCGAGTAATGGTCTTGTGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153698
VALIDATED
AAED1 MISSION shRNA shRNA Plasmid DNA
AhpC/TSA antioxidant enzyme domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153698.1-225s1c1
Sequence:CCGGGCGGCATTTCCTGTGTTACATCTCGAGATGTAACACAGGAAATGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-613s1c1
Sequence:CCGGCGCGATAGGAATAGGTTGGATCTCGAGATCCAACCTATTCCTATCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153698.1-658s1c1
Sequence:CCGGCAGCTTGTAGGAGTTCAGCATCTCGAGATGCTGAACTCCTACAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-237s1c1
Sequence:CCGGGTGTTACATCTGCAAGGAATACTCGAGTATTCCTTGCAGATGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153698.1-295s1c1
Sequence:CCGGCAAGAAGCAAATGTCACCCTTCTCGAGAAGGGTGACATTTGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153698.1-827s1c1
Sequence:CCGGGAGGAGTTAGGGAAGCATAAACTCGAGTTTATGCTTCCCTAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-336s1c1
Sequence:CCGGCTACCATCATATTGAGCCTTTCTCGAGAAAGGCTCAATATGATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-668s1c1
Sequence:CCGGGAGTTCAGCATGTGAACTTTACTCGAGTAAAGTTCACATGCTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153698.1-393s1c1
Sequence:CCGGCGATCCTGAGAGAGAAATTTACTCGAGTAAATTTCTCTCTCAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-1077s1c1
Sequence:CCGGGAGAACAACACAAGACCATTACTCGAGTAATGGTCTTGTGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153698
VALIDATED
AAED1 MISSION shRNA Lentiviral Transduction Particles
AhpC/TSA antioxidant enzyme domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153698.1-225s1c1
Sequence:CCGGGCGGCATTTCCTGTGTTACATCTCGAGATGTAACACAGGAAATGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-613s1c1
Sequence:CCGGCGCGATAGGAATAGGTTGGATCTCGAGATCCAACCTATTCCTATCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153698.1-658s1c1
Sequence:CCGGCAGCTTGTAGGAGTTCAGCATCTCGAGATGCTGAACTCCTACAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-237s1c1
Sequence:CCGGGTGTTACATCTGCAAGGAATACTCGAGTATTCCTTGCAGATGTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135319    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153698.1-295s1c1
Sequence:CCGGCAAGAAGCAAATGTCACCCTTCTCGAGAAGGGTGACATTTGCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153698.1-827s1c1
Sequence:CCGGGAGGAGTTAGGGAAGCATAAACTCGAGTTTATGCTTCCCTAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-336s1c1
Sequence:CCGGCTACCATCATATTGAGCCTTTCTCGAGAAAGGCTCAATATGATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-668s1c1
Sequence:CCGGGAGTTCAGCATGTGAACTTTACTCGAGTAAAGTTCACATGCTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153698.1-393s1c1
Sequence:CCGGCGATCCTGAGAGAGAAATTTACTCGAGTAAATTTCTCTCTCAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153698.1-1077s1c1
Sequence:CCGGGAGAACAACACAAGACCATTACTCGAGTAATGGTCTTGTGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks