EMAIL THIS PAGE TO A FRIEND

AAGAB

alpha- and gamma-adaptin binding protein

Synonyms: KPPP1 PPKP1 PPKP1A p34
UniProtKB ID: Q6PD74, Q6FI86, Q7Z5X9, Q9H0P1, Q9HAK0
Gene ID:
Human(79719) Summary: The protein encoded by this gene interacts with the gamma-adaptin and alpha-adaptin subunits of complexes involved in clathrin-coated vesicle trafficking. Mutations in this gene are associated with type I punctate palmoplantar keratoderma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(66939) alpha- and gamma-adaptin binding protein
Rat(171435) alpha- and gamma-adaptin binding protein
sheep(101103322) alpha- and gamma-adaptin binding protein
domestic guinea pig(100728106) alpha- and gamma-adaptin binding protein
naked mole-rat(101713008) alpha- and gamma-adaptin binding protein
Zebrafish(436696) alpha- and gamma-adaptin binding protein
chicken(415553) alpha- and gamma-adaptin binding protein
dog(610909) alpha- and gamma-adaptin binding protein
cow(507035) alpha- and gamma-adaptin binding protein
domestic cat(101101138) alpha- and gamma-adaptin binding protein
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024666 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024666 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024666 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024666 Rosetta Predictions human pricing
NM_134398 Rosetta Predictions rat pricing
NM_025857 Rosetta Predictions mouse pricing
XM_486226 Rosetta Predictions mouse pricing
XM_898582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037872 predicted 583
2 SASI_Hs01_00037873 predicted 638
3 SASI_Hs01_00037874 predicted 824
4 SASI_Hs01_00037875 predicted 608
5 SASI_Hs01_00037876 predicted 293
6 SASI_Hs01_00037877 predicted 735
7 SASI_Hs02_00357076 predicted 483
8 SASI_Hs01_00037878 predicted 978
9 SASI_Hs02_00357077 predicted 811
10 SASI_Hs02_00357078 predicted 576
11 SASI_Hs01_00037869 predicted 235
12 SASI_Hs01_00037870 predicted 263
13 SASI_Hs01_00037871 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267973 predicted 577
2 SASI_Rn01_00084433 predicted 660
3 SASI_Rn02_00267974 predicted 579
4 SASI_Rn01_00084434 predicted 213
5 SASI_Rn01_00084435 predicted 758
6 SASI_Rn01_00084436 predicted 406
7 SASI_Rn01_00084437 predicted 762
8 SASI_Rn01_00084438 predicted 370
9 SASI_Rn01_00084439 predicted 774
10 SASI_Rn02_00267975 predicted 755
11 SASI_Rn01_00084440 predicted 322
12 SASI_Rn01_00084441 predicted 387
13 SASI_Rn01_00084442 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329147 predicted 1215
2 SASI_Mm02_00329148 predicted 1160
3 SASI_Mm02_00329149 predicted 420
4 SASI_Mm02_00329150 predicted 1259
5 SASI_Mm02_00329151 predicted 490
6 SASI_Mm02_00329152 predicted 763
7 SASI_Mm02_00329153 predicted 779
8 SASI_Mm02_00329154 predicted 383
9 SASI_Mm02_00329155 predicted 969
10 SASI_Mm02_00329156 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248305 predicted 1230
2 SASI_Mm01_00248306 predicted 782
3 SASI_Mm01_00248307 predicted 527
4 SASI_Mm01_00248308 predicted 1178
5 SASI_Mm01_00248309 predicted 439
6 SASI_Mm01_00248310 predicted 1276
7 SASI_Mm01_00248311 predicted 505
8 SASI_Mm01_00248312 predicted 802
9 SASI_Mm01_00248313 predicted 394
10 SASI_Mm01_00248314 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216223 predicted 609
2 SASI_Mm01_00216224 predicted 844
3 SASI_Mm01_00216225 predicted 881
4 SASI_Mm01_00216226 predicted 786
5 SASI_Mm01_00216227 predicted 774
6 SASI_Mm01_00216228 predicted 787
7 SASI_Mm01_00216229 predicted 1102
8 SASI_Mm01_00216230 predicted 891
9 SASI_Mm01_00216231 predicted 1029
10 SASI_Mm01_00216232 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024666
VALIDATED
AAGAB MISSION shRNA Bacterial Glycerol Stock
alpha- and gamma-adaptin binding protein
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024666.2-246s1c1
Sequence:CCGGCCAAGCATTTGTGGTTTACTTCTCGAGAAGTAAACCACAAATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024666.2-585s1c1
Sequence:CCGGGACTGGAACAAACCATAGCATCTCGAGATGCTATGGTTTGTTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024666.2-890s1c1
Sequence:CCGGCCAAAGCATTCTGGATGGCAACTCGAGTTGCCATCCAGAATGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024666.2-2030s1c1
Sequence:CCGGCCAGAGGAACTGATAAGCAAACTCGAGTTTGCTTATCAGTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024666.2-733s1c1
Sequence:CCGGCCCATGTTAGATCTGGATATTCTCGAGAATATCCAGATCTAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024666.2-247s1c1
Sequence:CCGGCAAGCATTTGTGGTTTACTTTCTCGAGAAAGTAAACCACAAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024666.2-1487s1c1
Sequence:CCGGGCTAAGTCTCTACCTAAGAAACTCGAGTTTCTTAGGTAGAGACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024666.3-1577s21c1
Sequence:CCGGGCTAAGTCTCTACCTAAGAAACTCGAGTTTCTTAGGTAGAGACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024666.3-655s21c1
Sequence:CCGGTTTAGCCTTCTCAACTCATTGCTCGAGCAATGAGTTGAGAAGGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024666.3-572s21c1
Sequence:CCGGCTACAGGAGTAAAGCGAATTGCTCGAGCAATTCGCTTTACTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024666.3-183s21c1
Sequence:CCGGCCTTGGAACAGAAGATCTTATCTCGAGATAAGATCTTCTGTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024666.3-2120s21c1
Sequence:CCGGCCAGAGGAACTGATAAGCAAACTCGAGTTTGCTTATCAGTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024666
VALIDATED
AAGAB MISSION shRNA shRNA Plasmid DNA
alpha- and gamma-adaptin binding protein
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024666.2-246s1c1
Sequence:CCGGCCAAGCATTTGTGGTTTACTTCTCGAGAAGTAAACCACAAATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024666.2-585s1c1
Sequence:CCGGGACTGGAACAAACCATAGCATCTCGAGATGCTATGGTTTGTTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024666.2-890s1c1
Sequence:CCGGCCAAAGCATTCTGGATGGCAACTCGAGTTGCCATCCAGAATGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024666.2-2030s1c1
Sequence:CCGGCCAGAGGAACTGATAAGCAAACTCGAGTTTGCTTATCAGTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024666.2-733s1c1
Sequence:CCGGCCCATGTTAGATCTGGATATTCTCGAGAATATCCAGATCTAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024666.2-247s1c1
Sequence:CCGGCAAGCATTTGTGGTTTACTTTCTCGAGAAAGTAAACCACAAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024666.2-1487s1c1
Sequence:CCGGGCTAAGTCTCTACCTAAGAAACTCGAGTTTCTTAGGTAGAGACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024666.3-1577s21c1
Sequence:CCGGGCTAAGTCTCTACCTAAGAAACTCGAGTTTCTTAGGTAGAGACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024666.3-655s21c1
Sequence:CCGGTTTAGCCTTCTCAACTCATTGCTCGAGCAATGAGTTGAGAAGGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024666.3-572s21c1
Sequence:CCGGCTACAGGAGTAAAGCGAATTGCTCGAGCAATTCGCTTTACTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024666.3-183s21c1
Sequence:CCGGCCTTGGAACAGAAGATCTTATCTCGAGATAAGATCTTCTGTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024666.3-2120s21c1
Sequence:CCGGCCAGAGGAACTGATAAGCAAACTCGAGTTTGCTTATCAGTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024666
VALIDATED
AAGAB MISSION shRNA Lentiviral Transduction Particles
alpha- and gamma-adaptin binding protein
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024666.2-246s1c1
Sequence:CCGGCCAAGCATTTGTGGTTTACTTCTCGAGAAGTAAACCACAAATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024666.2-585s1c1
Sequence:CCGGGACTGGAACAAACCATAGCATCTCGAGATGCTATGGTTTGTTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024666.2-890s1c1
Sequence:CCGGCCAAAGCATTCTGGATGGCAACTCGAGTTGCCATCCAGAATGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122519    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024666.2-2030s1c1
Sequence:CCGGCCAGAGGAACTGATAAGCAAACTCGAGTTTGCTTATCAGTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024666.2-733s1c1
Sequence:CCGGCCCATGTTAGATCTGGATATTCTCGAGAATATCCAGATCTAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024666.2-247s1c1
Sequence:CCGGCAAGCATTTGTGGTTTACTTTCTCGAGAAAGTAAACCACAAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024666.2-1487s1c1
Sequence:CCGGGCTAAGTCTCTACCTAAGAAACTCGAGTTTCTTAGGTAGAGACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024666.3-1577s21c1
Sequence:CCGGGCTAAGTCTCTACCTAAGAAACTCGAGTTTCTTAGGTAGAGACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024666.3-655s21c1
Sequence:CCGGTTTAGCCTTCTCAACTCATTGCTCGAGCAATGAGTTGAGAAGGCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024666.3-572s21c1
Sequence:CCGGCTACAGGAGTAAAGCGAATTGCTCGAGCAATTCGCTTTACTCCTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024666.3-183s21c1
Sequence:CCGGCCTTGGAACAGAAGATCTTATCTCGAGATAAGATCTTCTGTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024666.3-2120s21c1
Sequence:CCGGCCAGAGGAACTGATAAGCAAACTCGAGTTTGCTTATCAGTTCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025857
VALIDATED
AAGAB MISSION shRNA Bacterial Glycerol Stock
alpha- and gamma-adaptin binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025857.2-976s21c1
Sequence:CCGGCTTCTGATGACGAGCACTAAGCTCGAGCTTAGTGCTCGTCATCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025857.2-424s21c1
Sequence:CCGGCTCAAGAGTGGTGCATCAAACCTCGAGGTTTGATGCACCACTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025857.2-503s21c1
Sequence:CCGGCCCTGAATCTACAGGTGTAAACTCGAGTTTACACCTGTAGATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025857.2-2399s21c1
Sequence:CCGGAGTGCATTCGCTACTGGTTAACTCGAGTTAACCAGTAGCGAATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025857.2-187s21c1
Sequence:CCGGCCATCGATAACAAGTACTATTCTCGAGAATAGTACTTGTTATCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025857
VALIDATED
AAGAB MISSION shRNA shRNA Plasmid DNA
alpha- and gamma-adaptin binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025857.2-976s21c1
Sequence:CCGGCTTCTGATGACGAGCACTAAGCTCGAGCTTAGTGCTCGTCATCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025857.2-424s21c1
Sequence:CCGGCTCAAGAGTGGTGCATCAAACCTCGAGGTTTGATGCACCACTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025857.2-503s21c1
Sequence:CCGGCCCTGAATCTACAGGTGTAAACTCGAGTTTACACCTGTAGATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025857.2-2399s21c1
Sequence:CCGGAGTGCATTCGCTACTGGTTAACTCGAGTTAACCAGTAGCGAATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025857.2-187s21c1
Sequence:CCGGCCATCGATAACAAGTACTATTCTCGAGAATAGTACTTGTTATCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025857
VALIDATED
AAGAB MISSION shRNA Lentiviral Transduction Particles
alpha- and gamma-adaptin binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025857.2-976s21c1
Sequence:CCGGCTTCTGATGACGAGCACTAAGCTCGAGCTTAGTGCTCGTCATCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025857.2-424s21c1
Sequence:CCGGCTCAAGAGTGGTGCATCAAACCTCGAGGTTTGATGCACCACTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025857.2-503s21c1
Sequence:CCGGCCCTGAATCTACAGGTGTAAACTCGAGTTTACACCTGTAGATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025857.2-2399s21c1
Sequence:CCGGAGTGCATTCGCTACTGGTTAACTCGAGTTAACCAGTAGCGAATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025857.2-187s21c1
Sequence:CCGGCCATCGATAACAAGTACTATTCTCGAGAATAGTACTTGTTATCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks