EMAIL THIS PAGE TO A FRIEND

AAK1

AP2 associated kinase 1

UniProtKB ID: Q2M2I8, Q4ZFZ3, Q53RX6, Q9UPV4
Gene ID:
Human(22848) Summary: Adaptor-related protein complex 2 (AP-2 complexes) functions during receptor-mediated endocytosis to trigger clathrin assembly, interact with membrane-bound receptors, and recruit encodytic accessory factors. This gene encodes a member of the SNF1 subfamily of Ser/Thr protein kinases. The protein interacts with and phosphorylates a subunit of the AP-2 complex, which promotes binding of AP-2 to sorting signals found in membrane-bound receptors and subsequent receptor endocytosis. Its kinase activity is stimulated by clathrin. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(269774) AP2 associated kinase 1
Rat(500244) AP2 associated kinase 1
chicken(419512) AP2 associated kinase 1
dog(474625) AP2 associated kinase 1
domestic cat(101094013) AP2 associated kinase 1
cow(532546) AP2 associated kinase 1
Horse(100050738) AP2 associated kinase 1
naked mole-rat(101700174) AP2 associated kinase 1
domestic guinea pig(100727491) AP2 associated kinase 1
sheep(101107425) AP2 associated kinase 1
Domestic Rabbit(100356781) AP2 associated kinase 1
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177762 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177762 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177762 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014911 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014911 Rosetta Predictions human pricing
XM_001070331 Rosetta Predictions rat pricing
XM_575594 Rosetta Predictions rat pricing
NM_001040106 Rosetta Predictions mouse pricing
NM_177762 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346550 predicted 788
2 SASI_Hs02_00346551 predicted 1227
3 SASI_Hs02_00346552 predicted 2586
4 SASI_Hs01_00162121 predicted 1067
5 SASI_Hs01_00162122 predicted 2875
6 SASI_Hs01_00162123 predicted 1611
7 SASI_Hs01_00162124 predicted 1449
8 SASI_Hs01_00162125 predicted 776
9 SASI_Hs01_00162126 predicted 812
10 SASI_Hs01_00162127 predicted 1242
11 SASI_Hs01_00162120 predicted 1305
12 SASI_Hs01_00162128 predicted 819
13 SASI_Hs01_00162129 predicted 2963
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331268 predicted 1380
2 SASI_Rn02_00331269 predicted 1635
3 SASI_Rn02_00331270 predicted 1389
4 SASI_Rn02_00331271 predicted 812
5 SASI_Rn02_00331272 predicted 3225
6 SASI_Rn02_00331273 predicted 1333
7 SASI_Rn02_00331274 predicted 801
8 SASI_Rn02_00331275 predicted 849
9 SASI_Rn02_00331276 predicted 1161
10 SASI_Rn02_00331277 predicted 2921
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403863 predicted 1383
2 SASI_Rn02_00403864 predicted 1636
3 SASI_Rn02_00403865 predicted 1391
4 SASI_Rn02_00403866 predicted 812
5 SASI_Rn02_00403867 predicted 3229
6 SASI_Rn02_00403868 predicted 1331
7 SASI_Rn02_00403869 predicted 808
8 SASI_Rn02_00403870 predicted 847
9 SASI_Rn02_00403871 predicted 1170
10 SASI_Rn02_00403872 predicted 2925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154669 predicted 756
2 SASI_Mm01_00154670 predicted 1638
3 SASI_Mm01_00154672 predicted 1381
4 SASI_Mm01_00154673 predicted 1303
5 SASI_Mm01_00154674 predicted 2897
6 SASI_Mm01_00154675 predicted 2576
7 SASI_Mm01_00154676 predicted 802
8 SASI_Mm01_00154677 predicted 818
9 SASI_Mm02_00290275 predicted 2856
10 SASI_Mm01_00154678 predicted 846
11 SASI_Mm01_00154671 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177762 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155487 predicted 754
2 SASI_Mm01_00155488 predicted 1641
3 SASI_Mm01_00155490 predicted 1376
4 SASI_Mm01_00155491 predicted 1303
5 SASI_Mm01_00155492 predicted 2656
6 SASI_Mm01_00155493 predicted 2332
7 SASI_Mm01_00155494 predicted 806
8 SASI_Mm01_00155495 predicted 817
9 SASI_Mm02_00348137 predicted 2619
10 SASI_Mm01_00155496 predicted 846
11 SASI_Mm01_00155489 predicted 1400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177762
VALIDATED
AAK1 MISSION shRNA Bacterial Glycerol Stock
AP2 associated kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177762.6-2946s21c1
Sequence:CCGGCTCTCTGCTCCCACTCATAAACTCGAGTTTATGAGTGGGAGCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177762.6-2186s21c1
Sequence:CCGGACGGATTCTCAGTGATGTAACCTCGAGGTTACATCACTGAGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177762.6-3043s21c1
Sequence:CCGGACCCTATTCCTGTACTAATTACTCGAGTAATTAGTACAGGAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177762.6-1393s21c1
Sequence:CCGGTGCACTGCCTTATTAGGTATACTCGAGTATACCTAATAAGGCAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177762.6-1252s21c1
Sequence:CCGGTCACTACGAAGGCAGATATTTCTCGAGAAATATCTGCCTTCGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177762.3-326s1c1
Sequence:CCGGGCTGCCTACAAGATTGTTTCACTCGAGTGAAACAATCTTGTAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177762.3-347s1c1
Sequence:CCGGCAAAGCAATAAGCAGCTGCTACTCGAGTAGCAGCTGCTTATTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177762.3-260s1c1
Sequence:CCGGGCTTTATCCAAATATTCTCGACTCGAGTCGAGAATATTTGGATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177762.3-330s1c2
Sequence:CCGGCCTACAAGATTGTTTCACAAACTCGAGTTTGTGAAACAATCTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177762
VALIDATED
AAK1 MISSION shRNA shRNA Plasmid DNA
AP2 associated kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177762.6-2946s21c1
Sequence:CCGGCTCTCTGCTCCCACTCATAAACTCGAGTTTATGAGTGGGAGCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177762.6-2186s21c1
Sequence:CCGGACGGATTCTCAGTGATGTAACCTCGAGGTTACATCACTGAGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177762.6-3043s21c1
Sequence:CCGGACCCTATTCCTGTACTAATTACTCGAGTAATTAGTACAGGAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177762.6-1393s21c1
Sequence:CCGGTGCACTGCCTTATTAGGTATACTCGAGTATACCTAATAAGGCAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177762.6-1252s21c1
Sequence:CCGGTCACTACGAAGGCAGATATTTCTCGAGAAATATCTGCCTTCGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177762.3-326s1c1
Sequence:CCGGGCTGCCTACAAGATTGTTTCACTCGAGTGAAACAATCTTGTAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177762.3-347s1c1
Sequence:CCGGCAAAGCAATAAGCAGCTGCTACTCGAGTAGCAGCTGCTTATTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177762.3-260s1c1
Sequence:CCGGGCTTTATCCAAATATTCTCGACTCGAGTCGAGAATATTTGGATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177762.3-330s1c2
Sequence:CCGGCCTACAAGATTGTTTCACAAACTCGAGTTTGTGAAACAATCTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177762
VALIDATED
AAK1 MISSION shRNA Lentiviral Transduction Particles
AP2 associated kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177762.6-2946s21c1
Sequence:CCGGCTCTCTGCTCCCACTCATAAACTCGAGTTTATGAGTGGGAGCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177762.6-2186s21c1
Sequence:CCGGACGGATTCTCAGTGATGTAACCTCGAGGTTACATCACTGAGAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177762.6-3043s21c1
Sequence:CCGGACCCTATTCCTGTACTAATTACTCGAGTAATTAGTACAGGAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177762.6-1393s21c1
Sequence:CCGGTGCACTGCCTTATTAGGTATACTCGAGTATACCTAATAAGGCAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177762.6-1252s21c1
Sequence:CCGGTCACTACGAAGGCAGATATTTCTCGAGAAATATCTGCCTTCGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177762.3-326s1c1
Sequence:CCGGGCTGCCTACAAGATTGTTTCACTCGAGTGAAACAATCTTGTAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177762.3-347s1c1
Sequence:CCGGCAAAGCAATAAGCAGCTGCTACTCGAGTAGCAGCTGCTTATTGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177762.3-260s1c1
Sequence:CCGGGCTTTATCCAAATATTCTCGACTCGAGTCGAGAATATTTGGATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177762.3-330s1c2
Sequence:CCGGCCTACAAGATTGTTTCACAAACTCGAGTTTGTGAAACAATCTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014911
VALIDATED
AAK1 MISSION shRNA Bacterial Glycerol Stock
AP2 associated kinase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014911.x-2586s1c1
Sequence:CCGGCCAGGCTTTCAATCAACCCAACTCGAGTTGGGTTGATTGAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014911.x-629s1c1
Sequence:CCGGCCAGGTGTGCAAGAGAGAAATCTCGAGATTTCTCTCTTGCACACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014911.x-969s1c1
Sequence:CCGGGCCACCAACAAATTCCAGAATCTCGAGATTCTGGAATTTGTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014911.x-2162s1c1
Sequence:CCGGCCCAGTAAGACAACAGCCAAACTCGAGTTTGGCTGTTGTCTTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014911.x-3143s1c1
Sequence:CCGGAGACTACCTTTACTGAACTTACTCGAGTAAGTTCAGTAAAGGTAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014911.2-2698s1c1
Sequence:CCGGGCGTGTCTGATCCTTTCATTCCTCGAGGAATGAAAGGATCAGACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014911.2-2971s1c1
Sequence:CCGGCTCACTTGTATCACTCCAAATCTCGAGATTTGGAGTGATACAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014911.2-3059s1c1
Sequence:CCGGCTAGAGTGGATCTCTTATGAACTCGAGTTCATAAGAGATCCACTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197095    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014911.2-3067s1c1
Sequence:CCGGGATCTCTTATGAATGAGGAGGCTCGAGCCTCCTCATTCATAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014911.2-1117s1c1
Sequence:CCGGCTCTTGGATGTTTGTTGTATACTCGAGTATACAACAAACATCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014911
VALIDATED
AAK1 MISSION shRNA shRNA Plasmid DNA
AP2 associated kinase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014911.x-2586s1c1
Sequence:CCGGCCAGGCTTTCAATCAACCCAACTCGAGTTGGGTTGATTGAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014911.x-629s1c1
Sequence:CCGGCCAGGTGTGCAAGAGAGAAATCTCGAGATTTCTCTCTTGCACACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014911.x-969s1c1
Sequence:CCGGGCCACCAACAAATTCCAGAATCTCGAGATTCTGGAATTTGTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014911.x-2162s1c1
Sequence:CCGGCCCAGTAAGACAACAGCCAAACTCGAGTTTGGCTGTTGTCTTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014911.x-3143s1c1
Sequence:CCGGAGACTACCTTTACTGAACTTACTCGAGTAAGTTCAGTAAAGGTAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014911.2-2698s1c1
Sequence:CCGGGCGTGTCTGATCCTTTCATTCCTCGAGGAATGAAAGGATCAGACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014911.2-2971s1c1
Sequence:CCGGCTCACTTGTATCACTCCAAATCTCGAGATTTGGAGTGATACAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014911.2-3059s1c1
Sequence:CCGGCTAGAGTGGATCTCTTATGAACTCGAGTTCATAAGAGATCCACTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197095    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014911.2-3067s1c1
Sequence:CCGGGATCTCTTATGAATGAGGAGGCTCGAGCCTCCTCATTCATAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014911.2-1117s1c1
Sequence:CCGGCTCTTGGATGTTTGTTGTATACTCGAGTATACAACAAACATCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014911
VALIDATED
AAK1 MISSION shRNA Lentiviral Transduction Particles
AP2 associated kinase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014911.x-2586s1c1
Sequence:CCGGCCAGGCTTTCAATCAACCCAACTCGAGTTGGGTTGATTGAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014911.x-629s1c1
Sequence:CCGGCCAGGTGTGCAAGAGAGAAATCTCGAGATTTCTCTCTTGCACACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_014911.x-969s1c1
Sequence:CCGGGCCACCAACAAATTCCAGAATCTCGAGATTCTGGAATTTGTTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_014911.x-2162s1c1
Sequence:CCGGCCCAGTAAGACAACAGCCAAACTCGAGTTTGGCTGTTGTCTTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014911.x-3143s1c1
Sequence:CCGGAGACTACCTTTACTGAACTTACTCGAGTAAGTTCAGTAAAGGTAGTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014911.2-2698s1c1
Sequence:CCGGGCGTGTCTGATCCTTTCATTCCTCGAGGAATGAAAGGATCAGACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194857    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_014911.2-2971s1c1
Sequence:CCGGCTCACTTGTATCACTCCAAATCTCGAGATTTGGAGTGATACAAGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014911.2-3059s1c1
Sequence:CCGGCTAGAGTGGATCTCTTATGAACTCGAGTTCATAAGAGATCCACTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197095    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014911.2-3067s1c1
Sequence:CCGGGATCTCTTATGAATGAGGAGGCTCGAGCCTCCTCATTCATAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014911.2-1117s1c1
Sequence:CCGGCTCTTGGATGTTTGTTGTATACTCGAGTATACAACAAACATCCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks