EMAIL THIS PAGE TO A FRIEND

AAMDC

adipogenesis associated, Mth938 domain containing

Synonyms: C11orf67 CK067
UniProtKB ID: Q9H7C9, Q96AQ4, Q9Y6B1
Gene ID:
Mouse(66273) adipogenesis associated Mth938 domain containing
Rat(361606) adipogenesis associated, Mth938 domain containing
naked mole-rat(101715454) adipogenesis associated, Mth938 domain containing
domestic guinea pig(100713364) adipogenesis associated, Mth938 domain containing
sheep(101110977) adipogenesis associated, Mth938 domain containing
Zebrafish(553802) adipogenesis associated, Mth938 domain containing
domestic cat(101081406) adipogenesis associated, Mth938 domain containing
cow(533224) adipogenesis associated, Mth938 domain containing
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183251 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183251 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183251 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014040 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024684 Rosetta Predictions human pricing
NM_001108493 Rosetta Predictions rat pricing
NM_183251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032820 predicted 194
2 SASI_Hs01_00032823 predicted 207
3 SASI_Hs02_00357121 predicted 213
4 SASI_Hs01_00032826 predicted 222
5 SASI_Hs01_00032827 predicted 225
6 SASI_Hs01_00032828 predicted 197
7 SASI_Hs01_00032819 predicted 214
8 SASI_Hs02_00357122 predicted 241
9 SASI_Hs02_00357123 predicted 248
10 SASI_Hs01_00032821 predicted 230
11 SASI_Hs01_00032822 predicted 203
12 SASI_Hs01_00032824 predicted 227
13 SASI_Hs01_00032825 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239189 predicted 309
2 SASI_Rn02_00239190 predicted 305
3 SASI_Rn02_00239191 predicted 586
4 SASI_Rn02_00239192 predicted 505
5 SASI_Rn02_00239193 predicted 362
6 SASI_Rn02_00239194 predicted 287
7 SASI_Rn02_00239195 predicted 427
8 SASI_Rn02_00239196 predicted 488
9 SASI_Rn02_00239197 predicted 293
10 SASI_Rn02_00239198 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033166 predicted 292
2 SASI_Mm01_00033167 predicted 214
3 SASI_Mm01_00033168 predicted 280
4 SASI_Mm01_00033169 predicted 231
5 SASI_Mm01_00033170 predicted 436
6 SASI_Mm01_00033171 predicted 220
7 SASI_Mm01_00033172 predicted 358
8 SASI_Mm01_00033173 predicted 383
9 SASI_Mm01_00033174 predicted 358
10 SASI_Mm01_00033175 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183251
VALIDATED
AAMDC MISSION shRNA Bacterial Glycerol Stock
adipogenesis associated, Mth938 domain containing
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183251.2-231s1c1
Sequence:CCGGCCTTAACCTATAAGGATTGCACTCGAGTGCAATCCTTATAGGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183251.2-237s1c1
Sequence:CCGGCCTATAAGGATTGCAAAGTATCTCGAGATACTTTGCAATCCTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183251.2-316s21c1
Sequence:CCGGAGTGCAGCCAGCAGATGTAAACTCGAGTTTACATCTGCTGGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183251.2-354s21c1
Sequence:CCGGGGGTACAGACTCTTGTGATTGCTCGAGCAATCACAAGAGTCTGTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183251.2-679s21c1
Sequence:CCGGTGCACTCCAGGTTGCTTAAATCTCGAGATTTAAGCAACCTGGAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183251.2-467s21c1
Sequence:CCGGCAGGCCGTGAAGGAGTATAATCTCGAGATTATACTCCTTCACGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183251.2-223s21c1
Sequence:CCGGAGGCTCTACCTTAACCTATAACTCGAGTTATAGGTTAAGGTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183251
VALIDATED
AAMDC MISSION shRNA shRNA Plasmid DNA
adipogenesis associated, Mth938 domain containing
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183251.2-231s1c1
Sequence:CCGGCCTTAACCTATAAGGATTGCACTCGAGTGCAATCCTTATAGGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183251.2-237s1c1
Sequence:CCGGCCTATAAGGATTGCAAAGTATCTCGAGATACTTTGCAATCCTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183251.2-316s21c1
Sequence:CCGGAGTGCAGCCAGCAGATGTAAACTCGAGTTTACATCTGCTGGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183251.2-354s21c1
Sequence:CCGGGGGTACAGACTCTTGTGATTGCTCGAGCAATCACAAGAGTCTGTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183251.2-679s21c1
Sequence:CCGGTGCACTCCAGGTTGCTTAAATCTCGAGATTTAAGCAACCTGGAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183251.2-467s21c1
Sequence:CCGGCAGGCCGTGAAGGAGTATAATCTCGAGATTATACTCCTTCACGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183251.2-223s21c1
Sequence:CCGGAGGCTCTACCTTAACCTATAACTCGAGTTATAGGTTAAGGTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183251
VALIDATED
AAMDC MISSION shRNA Lentiviral Transduction Particles
adipogenesis associated, Mth938 domain containing
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183251.2-231s1c1
Sequence:CCGGCCTTAACCTATAAGGATTGCACTCGAGTGCAATCCTTATAGGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191201    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183251.2-237s1c1
Sequence:CCGGCCTATAAGGATTGCAAAGTATCTCGAGATACTTTGCAATCCTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183251.2-316s21c1
Sequence:CCGGAGTGCAGCCAGCAGATGTAAACTCGAGTTTACATCTGCTGGCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183251.2-354s21c1
Sequence:CCGGGGGTACAGACTCTTGTGATTGCTCGAGCAATCACAAGAGTCTGTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183251.2-679s21c1
Sequence:CCGGTGCACTCCAGGTTGCTTAAATCTCGAGATTTAAGCAACCTGGAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183251.2-467s21c1
Sequence:CCGGCAGGCCGTGAAGGAGTATAATCTCGAGATTATACTCCTTCACGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_183251.2-223s21c1
Sequence:CCGGAGGCTCTACCTTAACCTATAACTCGAGTTATAGGTTAAGGTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014040
AAMDC MISSION shRNA Bacterial Glycerol Stock
adipogenesis associated, Mth938 domain containing
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000172861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014040.2-323s1c1
Sequence:CCGGGAAGGTGCCTTCATCAACTGTCTCGAGACAGTTGATGAAGGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014040.2-214s1c1
Sequence:CCGGGAGAAACAGGAACTGAGCATTCTCGAGAATGCTCAGTTCCTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014040
AAMDC MISSION shRNA shRNA Plasmid DNA
adipogenesis associated, Mth938 domain containing
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000172861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014040.2-323s1c1
Sequence:CCGGGAAGGTGCCTTCATCAACTGTCTCGAGACAGTTGATGAAGGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014040.2-214s1c1
Sequence:CCGGGAGAAACAGGAACTGAGCATTCTCGAGAATGCTCAGTTCCTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014040
AAMDC MISSION shRNA Lentiviral Transduction Particles
adipogenesis associated, Mth938 domain containing
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000172861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014040.2-323s1c1
Sequence:CCGGGAAGGTGCCTTCATCAACTGTCTCGAGACAGTTGATGAAGGCACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014040.2-214s1c1
Sequence:CCGGGAGAAACAGGAACTGAGCATTCTCGAGAATGCTCAGTTCCTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024684
VALIDATED
AAMDC MISSION shRNA Bacterial Glycerol Stock
adipogenesis associated, Mth938 domain containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024684.2-353s21c1
Sequence:CCGGCAAGAAACATGGCATTGATGTCTCGAGACATCAATGCCATGTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024684.2-195s21c1
Sequence:CCGGAGTCGGACTTGGGATTGGAGACTCGAGTCTCCAATCCCAAGTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024684.2-280s21c1
Sequence:CCGGGTGTACAGACTCTTGTGATTGCTCGAGCAATCACAAGAGTCTGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024684.2-253s21c1
Sequence:CCGGCAGATGTGAAGGAAGTTGTTGCTCGAGCAACAACTTCCTTCACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024684.2-149s21c1
Sequence:CCGGAGGCTCTAATACAACCTATAACTCGAGTTATAGGTTGTATTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024684
VALIDATED
AAMDC MISSION shRNA shRNA Plasmid DNA
adipogenesis associated, Mth938 domain containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024684.2-353s21c1
Sequence:CCGGCAAGAAACATGGCATTGATGTCTCGAGACATCAATGCCATGTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024684.2-195s21c1
Sequence:CCGGAGTCGGACTTGGGATTGGAGACTCGAGTCTCCAATCCCAAGTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024684.2-280s21c1
Sequence:CCGGGTGTACAGACTCTTGTGATTGCTCGAGCAATCACAAGAGTCTGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024684.2-253s21c1
Sequence:CCGGCAGATGTGAAGGAAGTTGTTGCTCGAGCAACAACTTCCTTCACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024684.2-149s21c1
Sequence:CCGGAGGCTCTAATACAACCTATAACTCGAGTTATAGGTTGTATTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024684
VALIDATED
AAMDC MISSION shRNA Lentiviral Transduction Particles
adipogenesis associated, Mth938 domain containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024684.2-353s21c1
Sequence:CCGGCAAGAAACATGGCATTGATGTCTCGAGACATCAATGCCATGTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024684.2-195s21c1
Sequence:CCGGAGTCGGACTTGGGATTGGAGACTCGAGTCTCCAATCCCAAGTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024684.2-280s21c1
Sequence:CCGGGTGTACAGACTCTTGTGATTGCTCGAGCAATCACAAGAGTCTGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024684.2-253s21c1
Sequence:CCGGCAGATGTGAAGGAAGTTGTTGCTCGAGCAACAACTTCCTTCACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024684.2-149s21c1
Sequence:CCGGAGGCTCTAATACAACCTATAACTCGAGTTATAGGTTGTATTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks