EMAIL THIS PAGE TO A FRIEND

AAMP

angio-associated, migratory cell protein

57 Gene Product Result for
UniProtKB ID: Q13685, Q8WUJ9, Q96H92
Gene ID:
Human(14) Summary: The gene product is an immunoglobulin-type protein. It is found to be expressed strongly in endothelial cells, cytotrophoblasts, and poorly differentiated colon adenocarcinoma cells found in lymphatics. The protein contains a heparin-binding domain and mediates heparin-sensitive cell adhesion. [provided by RefSeq, Jul 2008]
Mouse(227290) angio-associated migratory protein
Rat(301512) angio-associated, migratory cell protein
Zebrafish(405874) angio-associated, migratory cell protein
cow(767919) angio-associated, migratory cell protein
domestic cat(101086167) angio-associated, migratory cell protein
dog(478908) angio-associated, migratory cell protein
chicken(769880) angio-associated, migratory cell protein
sheep(101110742) angio-associated, migratory cell protein
domestic guinea pig(100723316) angio-associated, migratory cell protein
naked mole-rat(101711274) angio-associated, migratory cell protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146110 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146110 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146110 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001087 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001087 Rosetta Predictions human pricing
NM_001106920 Rosetta Predictions rat pricing
NM_146110 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058871 predicted 1035
2 SASI_Hs01_00058872 predicted 823
3 SASI_Hs01_00058873 predicted 664
4 SASI_Hs01_00058874 predicted 264
5 SASI_Hs01_00058875 predicted 914
6 SASI_Hs01_00058876 predicted 470
7 SASI_Hs01_00058877 predicted 541
8 SASI_Hs01_00058878 predicted 1498
9 SASI_Hs01_00058879 predicted 539
10 SASI_Hs01_00058880 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223706 predicted 2218
2 SASI_Rn02_00223707 predicted 1789
3 SASI_Rn02_00223708 predicted 1418
4 SASI_Rn02_00223709 predicted 2057
5 SASI_Rn02_00223710 predicted 1726
6 SASI_Rn02_00223711 predicted 1169
7 SASI_Rn02_00223712 predicted 1144
8 SASI_Rn02_00223713 predicted 1436
9 SASI_Rn02_00223714 predicted 1402
10 SASI_Rn02_00223715 predicted 2036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034697 predicted 1084
2 SASI_Mm01_00034698 predicted 1167
3 SASI_Mm01_00034700 predicted 219
4 SASI_Mm01_00034701 predicted 824
5 SASI_Mm02_00341767 predicted 292
6 SASI_Mm01_00034702 predicted 451
7 SASI_Mm01_00034703 predicted 1446
8 SASI_Mm01_00034704 predicted 1293
9 SASI_Mm01_00034705 predicted 457
10 SASI_Mm01_00034706 predicted 1360
11 SASI_Mm01_00034699 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146110
AAMP MISSION shRNA Bacterial Glycerol Stock
angio-associated, migratory cell protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146110.2-1299s21c1
Sequence:CCGGCATCAGGAGACCACAAAGCAACTCGAGTTGCTTTGTGGTCTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146110.2-658s21c1
Sequence:CCGGGAATGGTGACTGTAAGACCTTCTCGAGAAGGTCTTACAGTCACCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146110.2-1571s21c1
Sequence:CCGGCGTGTCTCTTTGACTTTGATTCTCGAGAATCAAAGTCAAAGAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146110.2-1483s21c1
Sequence:CCGGCCTGCTTACTCCTTGTCCTTTCTCGAGAAAGGACAAGGAGTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146110.1-1063s1c1
Sequence:CCGGCATCAGGAGACCACAAAGCAACTCGAGTTGCTTTGTGGTCTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146110.1-422s1c1
Sequence:CCGGGAATGGTGACTGTAAGACCTTCTCGAGAAGGTCTTACAGTCACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146110.1-1335s1c1
Sequence:CCGGCGTGTCTCTTTGACTTTGATTCTCGAGAATCAAAGTCAAAGAGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146110.1-205s1c1
Sequence:CCGGGCCACAAAGACTCTGTGACATCTCGAGATGTCACAGAGTCTTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146110.1-294s1c1
Sequence:CCGGCAGGTAGACACCAAGGAAGAACTCGAGTTCTTCCTTGGTGTCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146110.1-1247s1c1
Sequence:CCGGCCTGCTTACTCCTTGTCCTTTCTCGAGAAAGGACAAGGAGTAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146110
AAMP MISSION shRNA shRNA Plasmid DNA
angio-associated, migratory cell protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146110.2-1299s21c1
Sequence:CCGGCATCAGGAGACCACAAAGCAACTCGAGTTGCTTTGTGGTCTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146110.2-658s21c1
Sequence:CCGGGAATGGTGACTGTAAGACCTTCTCGAGAAGGTCTTACAGTCACCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146110.2-1571s21c1
Sequence:CCGGCGTGTCTCTTTGACTTTGATTCTCGAGAATCAAAGTCAAAGAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146110.2-1483s21c1
Sequence:CCGGCCTGCTTACTCCTTGTCCTTTCTCGAGAAAGGACAAGGAGTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146110.1-1063s1c1
Sequence:CCGGCATCAGGAGACCACAAAGCAACTCGAGTTGCTTTGTGGTCTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146110.1-422s1c1
Sequence:CCGGGAATGGTGACTGTAAGACCTTCTCGAGAAGGTCTTACAGTCACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146110.1-1335s1c1
Sequence:CCGGCGTGTCTCTTTGACTTTGATTCTCGAGAATCAAAGTCAAAGAGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146110.1-205s1c1
Sequence:CCGGGCCACAAAGACTCTGTGACATCTCGAGATGTCACAGAGTCTTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146110.1-294s1c1
Sequence:CCGGCAGGTAGACACCAAGGAAGAACTCGAGTTCTTCCTTGGTGTCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146110.1-1247s1c1
Sequence:CCGGCCTGCTTACTCCTTGTCCTTTCTCGAGAAAGGACAAGGAGTAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146110
AAMP MISSION shRNA Lentiviral Transduction Particles
angio-associated, migratory cell protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146110.2-1299s21c1
Sequence:CCGGCATCAGGAGACCACAAAGCAACTCGAGTTGCTTTGTGGTCTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146110.2-658s21c1
Sequence:CCGGGAATGGTGACTGTAAGACCTTCTCGAGAAGGTCTTACAGTCACCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146110.2-1571s21c1
Sequence:CCGGCGTGTCTCTTTGACTTTGATTCTCGAGAATCAAAGTCAAAGAGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146110.2-1483s21c1
Sequence:CCGGCCTGCTTACTCCTTGTCCTTTCTCGAGAAAGGACAAGGAGTAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146110.1-1063s1c1
Sequence:CCGGCATCAGGAGACCACAAAGCAACTCGAGTTGCTTTGTGGTCTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146110.1-422s1c1
Sequence:CCGGGAATGGTGACTGTAAGACCTTCTCGAGAAGGTCTTACAGTCACCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146110.1-1335s1c1
Sequence:CCGGCGTGTCTCTTTGACTTTGATTCTCGAGAATCAAAGTCAAAGAGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146110.1-205s1c1
Sequence:CCGGGCCACAAAGACTCTGTGACATCTCGAGATGTCACAGAGTCTTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146110.1-294s1c1
Sequence:CCGGCAGGTAGACACCAAGGAAGAACTCGAGTTCTTCCTTGGTGTCTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146110.1-1247s1c1
Sequence:CCGGCCTGCTTACTCCTTGTCCTTTCTCGAGAAAGGACAAGGAGTAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001087
VALIDATED
AAMP MISSION shRNA Bacterial Glycerol Stock
angio-associated, migratory cell protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001087.3-160s21c1
Sequence:CCGGGAGATTATCGAGGTGGTAGAACTCGAGTTCTACCACCTCGATAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001087.3-229s21c1
Sequence:CCGGGATGTGGACTTTGAGGAAGAACTCGAGTTCTTCCTCAAAGTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001087.3-1343s21c1
Sequence:CCGGGAGACCACAAAGCGAAAGTATCTCGAGATACTTTCGCTTTGTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001087.3-418s21c1
Sequence:CCGGGAAGATGACAAAGCCTTCGTACTCGAGTACGAAGGCTTTGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001087.1-357s1c1
Sequence:CCGGCAAGACCAATACCTTGGCAGTCTCGAGACTGCCAAGGTATTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001087.1-865s1c1
Sequence:CCGGGATGGCAGCTTGATCCTAACTCTCGAGAGTTAGGATCAAGCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-199s1c1
Sequence:CCGGGATGTGGACTTTGAGGAAGAACTCGAGTTCTTCCTCAAAGTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-190s1c1
Sequence:CCGGGAGATGGAAGATGTGGACTTTCTCGAGAAAGTCCACATCTTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-130s1c1
Sequence:CCGGGAGATTATCGAGGTGGTAGAACTCGAGTTCTACCACCTCGATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-1313s1c1
Sequence:CCGGGAGACCACAAAGCGAAAGTATCTCGAGATACTTTCGCTTTGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-388s1c1
Sequence:CCGGGAAGATGACAAAGCCTTCGTACTCGAGTACGAAGGCTTTGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001087
VALIDATED
AAMP MISSION shRNA shRNA Plasmid DNA
angio-associated, migratory cell protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001087.3-160s21c1
Sequence:CCGGGAGATTATCGAGGTGGTAGAACTCGAGTTCTACCACCTCGATAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001087.3-229s21c1
Sequence:CCGGGATGTGGACTTTGAGGAAGAACTCGAGTTCTTCCTCAAAGTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001087.3-1343s21c1
Sequence:CCGGGAGACCACAAAGCGAAAGTATCTCGAGATACTTTCGCTTTGTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001087.3-418s21c1
Sequence:CCGGGAAGATGACAAAGCCTTCGTACTCGAGTACGAAGGCTTTGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001087.1-357s1c1
Sequence:CCGGCAAGACCAATACCTTGGCAGTCTCGAGACTGCCAAGGTATTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001087.1-865s1c1
Sequence:CCGGGATGGCAGCTTGATCCTAACTCTCGAGAGTTAGGATCAAGCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-199s1c1
Sequence:CCGGGATGTGGACTTTGAGGAAGAACTCGAGTTCTTCCTCAAAGTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-190s1c1
Sequence:CCGGGAGATGGAAGATGTGGACTTTCTCGAGAAAGTCCACATCTTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-130s1c1
Sequence:CCGGGAGATTATCGAGGTGGTAGAACTCGAGTTCTACCACCTCGATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-1313s1c1
Sequence:CCGGGAGACCACAAAGCGAAAGTATCTCGAGATACTTTCGCTTTGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-388s1c1
Sequence:CCGGGAAGATGACAAAGCCTTCGTACTCGAGTACGAAGGCTTTGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001087
VALIDATED
AAMP MISSION shRNA Lentiviral Transduction Particles
angio-associated, migratory cell protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001087.3-160s21c1
Sequence:CCGGGAGATTATCGAGGTGGTAGAACTCGAGTTCTACCACCTCGATAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001087.3-229s21c1
Sequence:CCGGGATGTGGACTTTGAGGAAGAACTCGAGTTCTTCCTCAAAGTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001087.3-1343s21c1
Sequence:CCGGGAGACCACAAAGCGAAAGTATCTCGAGATACTTTCGCTTTGTGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001087.3-418s21c1
Sequence:CCGGGAAGATGACAAAGCCTTCGTACTCGAGTACGAAGGCTTTGTCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155639    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001087.1-357s1c1
Sequence:CCGGCAAGACCAATACCTTGGCAGTCTCGAGACTGCCAAGGTATTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001087.1-865s1c1
Sequence:CCGGGATGGCAGCTTGATCCTAACTCTCGAGAGTTAGGATCAAGCTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-199s1c1
Sequence:CCGGGATGTGGACTTTGAGGAAGAACTCGAGTTCTTCCTCAAAGTCCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-190s1c1
Sequence:CCGGGAGATGGAAGATGTGGACTTTCTCGAGAAAGTCCACATCTTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-130s1c1
Sequence:CCGGGAGATTATCGAGGTGGTAGAACTCGAGTTCTACCACCTCGATAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-1313s1c1
Sequence:CCGGGAGACCACAAAGCGAAAGTATCTCGAGATACTTTCGCTTTGTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001087.1-388s1c1
Sequence:CCGGGAAGATGACAAAGCCTTCGTACTCGAGTACGAAGGCTTTGTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks