EMAIL THIS PAGE TO A FRIEND

AANAT

aralkylamine N-acetyltransferase

56 Gene Product Result for
Synonyms: DSPS SNAT
UniProtKB ID: Q16613, A0AVF2, Q562F4
Gene ID:
Human(15) Summary: The protein encoded by this gene belongs to the acetyltransferase superfamily. It is the penultimate enzyme in melatonin synthesis and controls the night/day rhythm in melatonin production in the vertebrate pineal gland. Melatonin is essential for the function of the circadian clock that influences activity and sleep. This enzyme is regulated by cAMP-dependent phosphorylation that promotes its interaction with 14-3-3 proteins and thus protects the enzyme against proteasomal degradation. This gene may contribute to numerous genetic diseases such as delayed sleep phase syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(11298) arylalkylamine N-acetyltransferase
Rat(25120) aralkylamine N-acetyltransferase
naked mole-rat(101713893) aralkylamine N-acetyltransferase
domestic guinea pig(100724241) aralkylamine N-acetyltransferase
Goat(100860947) aralkylamine N-acetyltransferase
sheep(443531) aralkylamine N-acetyltransferase
chicken(396066) aralkylamine N-acetyltransferase
dog(483331) aralkylamine N-acetyltransferase
domestic cat(101098178) aralkylamine N-acetyltransferase
cow(281583) arylalkylamine N-acetyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001088 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001088 Rosetta Predictions human pricing
NM_012818 Rosetta Predictions rat pricing
NM_009591 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174652 predicted 375
2 SASI_Hs01_00174653 predicted 316
3 SASI_Hs01_00174654 predicted 453
4 SASI_Hs01_00174655 predicted 535
5 SASI_Hs01_00174656 predicted 367
6 SASI_Hs01_00174658 predicted 530
7 SASI_Hs01_00174659 predicted 373
8 SASI_Hs01_00174660 predicted 370
9 SASI_Hs01_00174661 predicted 730
10 SASI_Hs02_00318016 predicted 303
11 SASI_Hs01_00174657 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012818 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058874 predicted 244
2 SASI_Rn01_00058875 predicted 644
3 SASI_Rn01_00058877 predicted 415
4 SASI_Rn01_00058878 predicted 784
5 SASI_Rn02_00260267 predicted 350
6 SASI_Rn01_00058879 predicted 863
7 SASI_Rn02_00260268 predicted 805
8 SASI_Rn02_00260269 predicted 420
9 SASI_Rn01_00058880 predicted 662
10 SASI_Rn02_00260270 predicted 785
11 SASI_Rn01_00058876 predicted 350
12 SASI_Rn01_00058881 predicted 944
13 SASI_Rn01_00058882 predicted 938
14 SASI_Rn01_00058883 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096758 predicted 985
2 SASI_Mm01_00096759 predicted 764
3 SASI_Mm01_00096760 predicted 933
4 SASI_Mm01_00096761 predicted 988
5 SASI_Mm01_00096762 predicted 448
6 SASI_Mm02_00316494 predicted 306
7 SASI_Mm02_00316495 predicted 546
8 SASI_Mm01_00096764 predicted 986
9 SASI_Mm01_00096765 predicted 676
10 SASI_Mm02_00316496 predicted 712
11 SASI_Mm01_00096763 predicted 319
12 SASI_Mm01_00096766 predicted 351
13 SASI_Mm01_00096767 predicted 639
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001088
AANAT MISSION shRNA Bacterial Glycerol Stock
aralkylamine N-acetyltransferase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-335s1c1
Sequence:CCGGCCAGTGAGTTTCGCTGCCTCACTCGAGTGAGGCAGCGAAACTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-789s1c1
Sequence:CCGGCCTCACCTTCATGGAGCTCCACTCGAGTGGAGCTCCATGAAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-376s1c1
Sequence:CCGGGCCTTTGAGATCGAGCGTGAACTCGAGTTCACGCTCGATCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-393s1c1
Sequence:CCGGTGAAGCCTTCATCTCCGTCTTCTCGAGAAGACGGAGATGAAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-732s1c1
Sequence:CCGGCTTCTATGAGAGGTTCAGCTTCTCGAGAAGCTGAACCTCTCATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001088.2-564s21c1
Sequence:CCGGACTCATGCAGGAGTCACTGACCTCGAGGTCAGTGACTCCTGCATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001088.2-553s21c1
Sequence:CCGGGACAAGGAGAGACTCATGCAGCTCGAGCTGCATGAGTCTCTCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001088.2-519s21c1
Sequence:CCGGCTGCCTTGTGGCCTTCATCATCTCGAGATGATGAAGGCCACAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001088
AANAT MISSION shRNA shRNA Plasmid DNA
aralkylamine N-acetyltransferase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-335s1c1
Sequence:CCGGCCAGTGAGTTTCGCTGCCTCACTCGAGTGAGGCAGCGAAACTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-789s1c1
Sequence:CCGGCCTCACCTTCATGGAGCTCCACTCGAGTGGAGCTCCATGAAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-376s1c1
Sequence:CCGGGCCTTTGAGATCGAGCGTGAACTCGAGTTCACGCTCGATCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-393s1c1
Sequence:CCGGTGAAGCCTTCATCTCCGTCTTCTCGAGAAGACGGAGATGAAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-732s1c1
Sequence:CCGGCTTCTATGAGAGGTTCAGCTTCTCGAGAAGCTGAACCTCTCATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001088.2-564s21c1
Sequence:CCGGACTCATGCAGGAGTCACTGACCTCGAGGTCAGTGACTCCTGCATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001088.2-553s21c1
Sequence:CCGGGACAAGGAGAGACTCATGCAGCTCGAGCTGCATGAGTCTCTCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001088.2-519s21c1
Sequence:CCGGCTGCCTTGTGGCCTTCATCATCTCGAGATGATGAAGGCCACAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001088
AANAT MISSION shRNA Lentiviral Transduction Particles
aralkylamine N-acetyltransferase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-335s1c1
Sequence:CCGGCCAGTGAGTTTCGCTGCCTCACTCGAGTGAGGCAGCGAAACTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-789s1c1
Sequence:CCGGCCTCACCTTCATGGAGCTCCACTCGAGTGGAGCTCCATGAAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-376s1c1
Sequence:CCGGGCCTTTGAGATCGAGCGTGAACTCGAGTTCACGCTCGATCTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-393s1c1
Sequence:CCGGTGAAGCCTTCATCTCCGTCTTCTCGAGAAGACGGAGATGAAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001088.1-732s1c1
Sequence:CCGGCTTCTATGAGAGGTTCAGCTTCTCGAGAAGCTGAACCTCTCATAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001088.2-564s21c1
Sequence:CCGGACTCATGCAGGAGTCACTGACCTCGAGGTCAGTGACTCCTGCATGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001088.2-553s21c1
Sequence:CCGGGACAAGGAGAGACTCATGCAGCTCGAGCTGCATGAGTCTCTCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001088.2-519s21c1
Sequence:CCGGCTGCCTTGTGGCCTTCATCATCTCGAGATGATGAAGGCCACAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009591
AANAT MISSION shRNA Bacterial Glycerol Stock
aralkylamine N-acetyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009591.1-903s1c1
Sequence:CCGGCCAACTGGAGTACAGAGGTAACTCGAGTTACCTCTGTACTCCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009591.1-418s1c1
Sequence:CCGGCCTTCATCATTGGCTCGCTGTCTCGAGACAGCGAGCCAATGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009591.1-354s1c1
Sequence:CCGGCGGCACTTCCTAACCCTGTGTCTCGAGACACAGGGTTAGGAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009591.1-191s1c1
Sequence:CCGGGCCACTTGGGACCTCAGAGTTCTCGAGAACTCTGAGGTCCCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009591.1-636s1c1
Sequence:CCGGGTACCCTTCTATGAGAAATTTCTCGAGAAATTTCTCATAGAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009591
AANAT MISSION shRNA shRNA Plasmid DNA
aralkylamine N-acetyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009591.1-903s1c1
Sequence:CCGGCCAACTGGAGTACAGAGGTAACTCGAGTTACCTCTGTACTCCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009591.1-418s1c1
Sequence:CCGGCCTTCATCATTGGCTCGCTGTCTCGAGACAGCGAGCCAATGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009591.1-354s1c1
Sequence:CCGGCGGCACTTCCTAACCCTGTGTCTCGAGACACAGGGTTAGGAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009591.1-191s1c1
Sequence:CCGGGCCACTTGGGACCTCAGAGTTCTCGAGAACTCTGAGGTCCCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009591.1-636s1c1
Sequence:CCGGGTACCCTTCTATGAGAAATTTCTCGAGAAATTTCTCATAGAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009591
AANAT MISSION shRNA Lentiviral Transduction Particles
aralkylamine N-acetyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009591.1-903s1c1
Sequence:CCGGCCAACTGGAGTACAGAGGTAACTCGAGTTACCTCTGTACTCCAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009591.1-418s1c1
Sequence:CCGGCCTTCATCATTGGCTCGCTGTCTCGAGACAGCGAGCCAATGATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009591.1-354s1c1
Sequence:CCGGCGGCACTTCCTAACCCTGTGTCTCGAGACACAGGGTTAGGAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009591.1-191s1c1
Sequence:CCGGGCCACTTGGGACCTCAGAGTTCTCGAGAACTCTGAGGTCCCAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009591.1-636s1c1
Sequence:CCGGGTACCCTTCTATGAGAAATTTCTCGAGAAATTTCTCATAGAAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks