EMAIL THIS PAGE TO A FRIEND

AAR2

AAR2 splicing factor homolog (S. cerevisiae)

72 Gene Product Result for
Synonyms: C20orf4
UniProtKB ID: Q9Y312, E1P5S7, Q9H4F9, Q9P1P3, Q9UFK9
Gene ID:
Human(25980) Summary: This gene encodes the homolog of the yeast A1-alpha2 repressin protein that is involved in mRNA splicing. Alternately spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(68295) AAR2 splicing factor homolog (S. cerevisiae)
Rat(296312) AAR2 splicing factor homolog (S. cerevisiae)
naked mole-rat(101719132) AAR2 splicing factor homolog (S. cerevisiae)
domestic guinea pig(100725021) AAR2 splicing factor homolog (S. cerevisiae)
sheep(101121030) AAR2 splicing factor homolog (S. cerevisiae)
Zebrafish(431768) AAR2 splicing factor homolog (S. cerevisiae)
cow(533351) AAR2 splicing factor homolog (S. cerevisiae)
domestic cat(101098530) AAR2 splicing factor homolog (S. cerevisiae)
dog(477218) AAR2 splicing factor homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015511 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015511 Rosetta Predictions human pricing
NM_001106535 Rosetta Predictions rat pricing
NM_026661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107092 predicted 1247
2 SASI_Hs01_00107093 predicted 388
3 SASI_Hs01_00107094 predicted 514
4 SASI_Hs01_00107095 predicted 740
5 SASI_Hs01_00107096 predicted 473
6 SASI_Hs02_00347996 predicted 1767
7 SASI_Hs01_00107098 predicted 677
8 SASI_Hs01_00107099 predicted 369
9 SASI_Hs01_00107100 predicted 1095
10 SASI_Hs01_00107101 predicted 1682
11 SASI_Hs01_00107097 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219908 predicted 1293
2 SASI_Rn02_00219909 predicted 1174
3 SASI_Rn02_00219910 predicted 982
4 SASI_Rn02_00219911 predicted 466
5 SASI_Rn02_00219912 predicted 1983
6 SASI_Rn02_00219913 predicted 1222
7 SASI_Rn02_00219914 predicted 649
8 SASI_Rn02_00219915 predicted 595
9 SASI_Rn02_00219916 predicted 1157
10 SASI_Rn02_00219917 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330651 predicted 697
2 SASI_Mm01_00080519 predicted 937
3 SASI_Mm01_00080520 predicted 1122
4 SASI_Mm01_00080521 predicted 415
5 SASI_Mm01_00080522 predicted 1743
6 SASI_Mm01_00080523 predicted 1639
7 SASI_Mm01_00080524 predicted 680
8 SASI_Mm01_00080525 predicted 953
9 SASI_Mm01_00080526 predicted 800
10 SASI_Mm01_00080527 predicted 1617
11 SASI_Mm01_00080528 predicted 1785
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026661
AAR2 MISSION shRNA Bacterial Glycerol Stock
AAR2 splicing factor homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026661.3-2893s21c1
Sequence:CCGGCCCAACAAATGAATTTCTGATCTCGAGATCAGAAATTCATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026661.3-2789s21c1
Sequence:CCGGGCTCTACATTAACCTCAAGTTCTCGAGAACTTGAGGTTAATGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026661.3-1122s1c1
Sequence:CCGGGGCAATGTGTATGAGGCATTTCTCGAGAAATGCCTCATACACATTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026661.3-728s21c1
Sequence:CCGGGATCTCACTCACCAACTTCATCTCGAGATGAAGTTGGTGAGTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026661.3-416s21c1
Sequence:CCGGGACAGAGTTTGGCATTGACTACTCGAGTAGTCAATGCCAAACTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026661.2-1616s1c1
Sequence:CCGGGCTCACCATAATACGTTCCTTCTCGAGAAGGAACGTATTATGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026661.2-417s1c1
Sequence:CCGGGACAGAGTTTGGCATTGACTACTCGAGTAGTCAATGCCAAACTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177626    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026661.2-2894s1c1
Sequence:CCGGCCCAACAAATGAATTTCTGATCTCGAGATCAGAAATTCATTTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026661.2-2790s1c1
Sequence:CCGGGCTCTACATTAACCTCAAGTTCTCGAGAACTTGAGGTTAATGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026661.2-729s1c1
Sequence:CCGGGATCTCACTCACCAACTTCATCTCGAGATGAAGTTGGTGAGTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026661
AAR2 MISSION shRNA shRNA Plasmid DNA
AAR2 splicing factor homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026661.3-2893s21c1
Sequence:CCGGCCCAACAAATGAATTTCTGATCTCGAGATCAGAAATTCATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026661.3-2789s21c1
Sequence:CCGGGCTCTACATTAACCTCAAGTTCTCGAGAACTTGAGGTTAATGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026661.3-1122s1c1
Sequence:CCGGGGCAATGTGTATGAGGCATTTCTCGAGAAATGCCTCATACACATTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026661.3-728s21c1
Sequence:CCGGGATCTCACTCACCAACTTCATCTCGAGATGAAGTTGGTGAGTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026661.3-416s21c1
Sequence:CCGGGACAGAGTTTGGCATTGACTACTCGAGTAGTCAATGCCAAACTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026661.2-1616s1c1
Sequence:CCGGGCTCACCATAATACGTTCCTTCTCGAGAAGGAACGTATTATGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026661.2-417s1c1
Sequence:CCGGGACAGAGTTTGGCATTGACTACTCGAGTAGTCAATGCCAAACTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177626    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026661.2-2894s1c1
Sequence:CCGGCCCAACAAATGAATTTCTGATCTCGAGATCAGAAATTCATTTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026661.2-2790s1c1
Sequence:CCGGGCTCTACATTAACCTCAAGTTCTCGAGAACTTGAGGTTAATGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026661.2-729s1c1
Sequence:CCGGGATCTCACTCACCAACTTCATCTCGAGATGAAGTTGGTGAGTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026661
AAR2 MISSION shRNA Lentiviral Transduction Particles
AAR2 splicing factor homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026661.3-2893s21c1
Sequence:CCGGCCCAACAAATGAATTTCTGATCTCGAGATCAGAAATTCATTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026661.3-2789s21c1
Sequence:CCGGGCTCTACATTAACCTCAAGTTCTCGAGAACTTGAGGTTAATGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026661.3-1122s1c1
Sequence:CCGGGGCAATGTGTATGAGGCATTTCTCGAGAAATGCCTCATACACATTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026661.3-728s21c1
Sequence:CCGGGATCTCACTCACCAACTTCATCTCGAGATGAAGTTGGTGAGTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026661.3-416s21c1
Sequence:CCGGGACAGAGTTTGGCATTGACTACTCGAGTAGTCAATGCCAAACTCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198403    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026661.2-1616s1c1
Sequence:CCGGGCTCACCATAATACGTTCCTTCTCGAGAAGGAACGTATTATGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026661.2-417s1c1
Sequence:CCGGGACAGAGTTTGGCATTGACTACTCGAGTAGTCAATGCCAAACTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177626    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026661.2-2894s1c1
Sequence:CCGGCCCAACAAATGAATTTCTGATCTCGAGATCAGAAATTCATTTGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026661.2-2790s1c1
Sequence:CCGGGCTCTACATTAACCTCAAGTTCTCGAGAACTTGAGGTTAATGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026661.2-729s1c1
Sequence:CCGGGATCTCACTCACCAACTTCATCTCGAGATGAAGTTGGTGAGTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015511
AAR2 MISSION shRNA Bacterial Glycerol Stock
AAR2 splicing factor homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015511.2-2470s1c1
Sequence:CCGGCCCTGACATCAAACTGTTGTACTCGAGTACAACAGTTTGATGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-1237s1c1
Sequence:CCGGGCTGACTTCTTCGTAGACATTCTCGAGAATGTCTACGAAGAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015511.2-1802s1c1
Sequence:CCGGCCAAGAAAGAACTGATTGCTTCTCGAGAAGCAATCAGTTCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015511.2-1110s1c1
Sequence:CCGGCGAGGCATTTGAGCATTGGAACTCGAGTTCCAATGCTCAAATGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-523s1c1
Sequence:CCGGCCTCGTATGGGTTTCTTCCTTCTCGAGAAGGAAGAAACCCATACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-702s1c1
Sequence:CCGGGTGGATCTCACTCACCAACTTCTCGAGAAGTTGGTGAGTGAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-712s1c1
Sequence:CCGGCTCACCAACTTCATCAGCGAACTCGAGTTCGCTGATGAAGTTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015511.2-1017s1c1
Sequence:CCGGGACTGTGCTCAACAAGCAGTTCTCGAGAACTGCTTGTTGAGCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-496s1c1
Sequence:CCGGGACAAGGCTAATCCGAAGGAACTCGAGTTCCTTCGGATTAGCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015511.2-699s1c1
Sequence:CCGGGAAGTGGATCTCACTCACCAACTCGAGTTGGTGAGTGAGATCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015511
AAR2 MISSION shRNA shRNA Plasmid DNA
AAR2 splicing factor homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015511.2-2470s1c1
Sequence:CCGGCCCTGACATCAAACTGTTGTACTCGAGTACAACAGTTTGATGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-1237s1c1
Sequence:CCGGGCTGACTTCTTCGTAGACATTCTCGAGAATGTCTACGAAGAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015511.2-1802s1c1
Sequence:CCGGCCAAGAAAGAACTGATTGCTTCTCGAGAAGCAATCAGTTCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015511.2-1110s1c1
Sequence:CCGGCGAGGCATTTGAGCATTGGAACTCGAGTTCCAATGCTCAAATGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-523s1c1
Sequence:CCGGCCTCGTATGGGTTTCTTCCTTCTCGAGAAGGAAGAAACCCATACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-702s1c1
Sequence:CCGGGTGGATCTCACTCACCAACTTCTCGAGAAGTTGGTGAGTGAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-712s1c1
Sequence:CCGGCTCACCAACTTCATCAGCGAACTCGAGTTCGCTGATGAAGTTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015511.2-1017s1c1
Sequence:CCGGGACTGTGCTCAACAAGCAGTTCTCGAGAACTGCTTGTTGAGCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-496s1c1
Sequence:CCGGGACAAGGCTAATCCGAAGGAACTCGAGTTCCTTCGGATTAGCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015511.2-699s1c1
Sequence:CCGGGAAGTGGATCTCACTCACCAACTCGAGTTGGTGAGTGAGATCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015511
AAR2 MISSION shRNA Lentiviral Transduction Particles
AAR2 splicing factor homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015511.2-2470s1c1
Sequence:CCGGCCCTGACATCAAACTGTTGTACTCGAGTACAACAGTTTGATGTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152940    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-1237s1c1
Sequence:CCGGGCTGACTTCTTCGTAGACATTCTCGAGAATGTCTACGAAGAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151945    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015511.2-1802s1c1
Sequence:CCGGCCAAGAAAGAACTGATTGCTTCTCGAGAAGCAATCAGTTCTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015511.2-1110s1c1
Sequence:CCGGCGAGGCATTTGAGCATTGGAACTCGAGTTCCAATGCTCAAATGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-523s1c1
Sequence:CCGGCCTCGTATGGGTTTCTTCCTTCTCGAGAAGGAAGAAACCCATACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-702s1c1
Sequence:CCGGGTGGATCTCACTCACCAACTTCTCGAGAAGTTGGTGAGTGAGATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-712s1c1
Sequence:CCGGCTCACCAACTTCATCAGCGAACTCGAGTTCGCTGATGAAGTTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015511.2-1017s1c1
Sequence:CCGGGACTGTGCTCAACAAGCAGTTCTCGAGAACTGCTTGTTGAGCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015511.2-496s1c1
Sequence:CCGGGACAAGGCTAATCCGAAGGAACTCGAGTTCCTTCGGATTAGCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015511.2-699s1c1
Sequence:CCGGGAAGTGGATCTCACTCACCAACTCGAGTTGGTGAGTGAGATCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks