EMAIL THIS PAGE TO A FRIEND

AARD

alanine and arginine rich domain containing protein

44 Gene Product Result for
Synonyms: C8orf85
UniProtKB ID: Q4LEZ3, A5PKU8
Gene ID:
Mouse(239435) alanine and arginine rich domain containing protein
Rat(246323) alanine and arginine rich domain containing protein
cow(616184) alanine and arginine rich domain containing protein
sheep(101120843) alanine and arginine rich domain containing protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175503 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175503 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175503 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001025357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025357 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063071 MISSION® esiRNA esiRNA targeting mouse Aard (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025357 Rosetta Predictions human pricing
NM_145093 Rosetta Predictions rat pricing
NM_175503 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110671 predicted 59
2 SASI_Hs01_00110672 predicted 350
3 SASI_Hs01_00110673 predicted 313
4 SASI_Hs01_00110674 predicted 337
5 SASI_Hs01_00110675 predicted 15
6 SASI_Hs01_00110676 predicted 396
7 SASI_Hs01_00110677 predicted 341
8 SASI_Hs01_00110678 predicted 13
9 SASI_Hs01_00110679 predicted 340
10 SASI_Hs02_00307449 predicted 62
11 SASI_Hs01_00110680 predicted 25
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066782 predicted 647
2 SASI_Rn01_00066783 predicted 599
3 SASI_Rn01_00066784 predicted 836
4 SASI_Rn01_00066785 predicted 547
5 SASI_Rn02_00268689 predicted 681
6 SASI_Rn02_00268690 predicted 987
7 SASI_Rn01_00066786 predicted 966
8 SASI_Rn01_00066787 predicted 498
9 SASI_Rn01_00066788 predicted 806
10 SASI_Rn01_00066790 predicted 729
11 SASI_Rn01_00066789 predicted 619
12 SASI_Rn01_00066791 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175503 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024096 predicted 1060
2 SASI_Mm02_00346417 predicted 984
3 SASI_Mm01_00024097 predicted 799
4 SASI_Mm01_00024098 predicted 689
5 SASI_Mm01_00024099 predicted 1014
6 SASI_Mm01_00024101 predicted 617
7 SASI_Mm01_00024102 predicted 891
8 SASI_Mm01_00024103 predicted 924
9 SASI_Mm01_00024104 predicted 873
10 SASI_Mm01_00024105 predicted 664
11 SASI_Mm01_00024100 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175503
AARD MISSION shRNA Bacterial Glycerol Stock
alanine and arginine rich domain containing protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175503.2-459s1c1
Sequence:CCGGCGAACTTTACTGGATTTAAACCTCGAGGTTTAAATCCAGTAAAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196239    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175503.2-667s1c1
Sequence:CCGGGCGATGCTTATGTGTGCTCTACTCGAGTAGAGCACACATAAGCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175503.2-924s1c1
Sequence:CCGGGCAGTGCATGAACTTGCAGAACTCGAGTTCTGCAAGTTCATGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175503.3-792s21c1
Sequence:CCGGCATTGGTTTGACTGGTTATTGCTCGAGCAATAACCAGTCAAACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175503.3-559s21c1
Sequence:CCGGTTCCGAGTGTGGAAGCGCATACTCGAGTATGCGCTTCCACACTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175503.3-456s21c1
Sequence:CCGGCCCGAACTTTACTGGATTTAACTCGAGTTAAATCCAGTAAAGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175503.3-124s21c1
Sequence:CCGGACTCTACGGAGTCTCTGGAAGCTCGAGCTTCCAGAGACTCCGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175503.3-419s21c1
Sequence:CCGGGAGCTGCTGGAACTGCGTTTCCTCGAGGAAACGCAGTTCCAGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175503
AARD MISSION shRNA shRNA Plasmid DNA
alanine and arginine rich domain containing protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175503.2-459s1c1
Sequence:CCGGCGAACTTTACTGGATTTAAACCTCGAGGTTTAAATCCAGTAAAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196239    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175503.2-667s1c1
Sequence:CCGGGCGATGCTTATGTGTGCTCTACTCGAGTAGAGCACACATAAGCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175503.2-924s1c1
Sequence:CCGGGCAGTGCATGAACTTGCAGAACTCGAGTTCTGCAAGTTCATGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175503.3-792s21c1
Sequence:CCGGCATTGGTTTGACTGGTTATTGCTCGAGCAATAACCAGTCAAACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175503.3-559s21c1
Sequence:CCGGTTCCGAGTGTGGAAGCGCATACTCGAGTATGCGCTTCCACACTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175503.3-456s21c1
Sequence:CCGGCCCGAACTTTACTGGATTTAACTCGAGTTAAATCCAGTAAAGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175503.3-124s21c1
Sequence:CCGGACTCTACGGAGTCTCTGGAAGCTCGAGCTTCCAGAGACTCCGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175503.3-419s21c1
Sequence:CCGGGAGCTGCTGGAACTGCGTTTCCTCGAGGAAACGCAGTTCCAGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175503
AARD MISSION shRNA Lentiviral Transduction Particles
alanine and arginine rich domain containing protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175503.2-459s1c1
Sequence:CCGGCGAACTTTACTGGATTTAAACCTCGAGGTTTAAATCCAGTAAAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196239    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175503.2-667s1c1
Sequence:CCGGGCGATGCTTATGTGTGCTCTACTCGAGTAGAGCACACATAAGCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175503.2-924s1c1
Sequence:CCGGGCAGTGCATGAACTTGCAGAACTCGAGTTCTGCAAGTTCATGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175503.3-792s21c1
Sequence:CCGGCATTGGTTTGACTGGTTATTGCTCGAGCAATAACCAGTCAAACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175503.3-559s21c1
Sequence:CCGGTTCCGAGTGTGGAAGCGCATACTCGAGTATGCGCTTCCACACTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175503.3-456s21c1
Sequence:CCGGCCCGAACTTTACTGGATTTAACTCGAGTTAAATCCAGTAAAGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175503.3-124s21c1
Sequence:CCGGACTCTACGGAGTCTCTGGAAGCTCGAGCTTCCAGAGACTCCGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175503.3-419s21c1
Sequence:CCGGGAGCTGCTGGAACTGCGTTTCCTCGAGGAAACGCAGTTCCAGCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025357
AARD MISSION shRNA Bacterial Glycerol Stock
alanine and arginine rich domain containing protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025357.1-355s1c1
Sequence:CCGGGCTAGAACTTTACTGGACCTACTCGAGTAGGTCCAGTAAAGTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025357.1-359s1c1
Sequence:CCGGGAACTTTACTGGACCTAAACACTCGAGTGTTTAGGTCCAGTAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025357.1-356s1c1
Sequence:CCGGCTAGAACTTTACTGGACCTAACTCGAGTTAGGTCCAGTAAAGTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025357.1-569s1c1
Sequence:CCGGCATCCTGGCTAACACTGTGAACTCGAGTTCACAGTGTTAGCCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025357.1-415s1c1
Sequence:CCGGGAAATTACATCAGACTCCCAACTCGAGTTGGGAGTCTGATGTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025357
AARD MISSION shRNA shRNA Plasmid DNA
alanine and arginine rich domain containing protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025357.1-355s1c1
Sequence:CCGGGCTAGAACTTTACTGGACCTACTCGAGTAGGTCCAGTAAAGTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025357.1-359s1c1
Sequence:CCGGGAACTTTACTGGACCTAAACACTCGAGTGTTTAGGTCCAGTAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025357.1-356s1c1
Sequence:CCGGCTAGAACTTTACTGGACCTAACTCGAGTTAGGTCCAGTAAAGTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025357.1-569s1c1
Sequence:CCGGCATCCTGGCTAACACTGTGAACTCGAGTTCACAGTGTTAGCCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025357.1-415s1c1
Sequence:CCGGGAAATTACATCAGACTCCCAACTCGAGTTGGGAGTCTGATGTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025357
AARD MISSION shRNA Lentiviral Transduction Particles
alanine and arginine rich domain containing protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025357.1-355s1c1
Sequence:CCGGGCTAGAACTTTACTGGACCTACTCGAGTAGGTCCAGTAAAGTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025357.1-359s1c1
Sequence:CCGGGAACTTTACTGGACCTAAACACTCGAGTGTTTAGGTCCAGTAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025357.1-356s1c1
Sequence:CCGGCTAGAACTTTACTGGACCTAACTCGAGTTAGGTCCAGTAAAGTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122476    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025357.1-569s1c1
Sequence:CCGGCATCCTGGCTAACACTGTGAACTCGAGTTCACAGTGTTAGCCAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025357.1-415s1c1
Sequence:CCGGGAAATTACATCAGACTCCCAACTCGAGTTGGGAGTCTGATGTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks