EMAIL THIS PAGE TO A FRIEND

AARS2

alanyl-tRNA synthetase 2, mitochondrial

51 Gene Product Result for
Synonyms: AARSL COXPD8 MT-ALARS MTALARS
UniProtKB ID: Q5JTZ9, A2RRN5, Q8N198, Q96D02, Q9ULF0
Gene ID:
Human(57505) Summary: The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. Aminoacyl-tRNA synthetases play critical roles in mRNA translation by charging tRNAs with their cognate amino acids. The encoded protein is a mitochondrial enzyme that specifically aminoacylates alanyl-tRNA. Mutations in this gene are a cause of combined oxidative phosphorylation deficiency 8. [provided by RefSeq, Dec 2011]
Mouse(224805) alanyl-tRNA synthetase 2, mitochondrial (putative)
Rat(301254) alanyl-tRNA synthetase 2, mitochondrial
Zebrafish(792787) alanyl-tRNA synthetase 2, mitochondrial (putative)
dog(474920) alanyl-tRNA synthetase 2, mitochondrial
domestic cat(101096567) alanyl-tRNA synthetase 2, mitochondrial
cow(786099) alanyl-tRNA synthetase 2, mitochondrial (putative)
Horse(100067843) alanyl-tRNA synthetase 2, mitochondrial
chicken(421436) alanyl-tRNA synthetase 2, mitochondrial (putative)
sheep(101114732) alanyl-tRNA synthetase 2, mitochondrial
domestic guinea pig(100729382) alanyl-tRNA synthetase 2, mitochondrial
naked mole-rat(101726741) alanyl-tRNA synthetase 2, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_128656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020745 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020745 Rosetta Predictions human pricing
NM_001106891 Rosetta Predictions rat pricing
NM_198608 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094960 predicted 1454
2 SASI_Hs01_00094961 predicted 2914
3 SASI_Hs01_00094962 predicted 1783
4 SASI_Hs01_00094965 predicted 1469
5 SASI_Hs01_00094966 predicted 727
6 SASI_Hs01_00094967 predicted 316
7 SASI_Hs02_00353849 predicted 2466
8 SASI_Hs02_00353850 predicted 1071
9 SASI_Hs02_00353851 predicted 340
10 SASI_Hs02_00353852 predicted 1567
11 SASI_Hs01_00094958 predicted 385
12 SASI_Hs01_00094959 predicted 846
13 SASI_Hs01_00094963 predicted 382
14 SASI_Hs01_00094964 predicted 2921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223426 predicted 482
2 SASI_Rn02_00223427 predicted 648
3 SASI_Rn02_00223428 predicted 2941
4 SASI_Rn02_00223429 predicted 1994
5 SASI_Rn02_00223430 predicted 3003
6 SASI_Rn02_00223431 predicted 487
7 SASI_Rn02_00223432 predicted 709
8 SASI_Rn02_00223433 predicted 2485
9 SASI_Rn02_00223434 predicted 964
10 SASI_Rn02_00223435 predicted 2472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040874 predicted 1675
2 SASI_Mm01_00040875 predicted 1675
3 SASI_Mm01_00040876 predicted 710
4 SASI_Mm01_00040877 predicted 1031
5 SASI_Mm01_00040878 predicted 1148
6 SASI_Mm01_00040879 predicted 557
7 SASI_Mm01_00040880 predicted 1535
8 SASI_Mm01_00040881 predicted 1306
9 SASI_Mm01_00040882 predicted 1468
10 SASI_Mm01_00040883 predicted 1071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128656
VALIDATED
AARS2 MISSION shRNA Bacterial Glycerol Stock
alanyl-tRNA synthetase 2, mitochondrial
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128656.4-3088s1c1
Sequence:CCGGCCACCAGGAGACTGTAAGAAACTCGAGTTTCTTACAGTCTCCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128656.4-1529s1c1
Sequence:CCGGCCCAAGTATAACTACACTCTTCTCGAGAAGAGTGTAGTTATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128656.4-1653s1c1
Sequence:CCGGGTGGCCTCCTATTAGATAGAACTCGAGTTCTATCTAATAGGAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128656.4-1159s1c1
Sequence:CCGGTGAGAAGAACTCAGTCAAGATCTCGAGATCTTGACTGAGTTCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128656.4-695s1c2
Sequence:CCGGCAGCTGGTAGAGCTTTGGAATCTCGAGATTCCAAAGCTCTACCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128656
VALIDATED
AARS2 MISSION shRNA shRNA Plasmid DNA
alanyl-tRNA synthetase 2, mitochondrial
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128656.4-3088s1c1
Sequence:CCGGCCACCAGGAGACTGTAAGAAACTCGAGTTTCTTACAGTCTCCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128656.4-1529s1c1
Sequence:CCGGCCCAAGTATAACTACACTCTTCTCGAGAAGAGTGTAGTTATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128656.4-1653s1c1
Sequence:CCGGGTGGCCTCCTATTAGATAGAACTCGAGTTCTATCTAATAGGAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128656.4-1159s1c1
Sequence:CCGGTGAGAAGAACTCAGTCAAGATCTCGAGATCTTGACTGAGTTCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128656.4-695s1c2
Sequence:CCGGCAGCTGGTAGAGCTTTGGAATCTCGAGATTCCAAAGCTCTACCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128656
VALIDATED
AARS2 MISSION shRNA Lentiviral Transduction Particles
alanyl-tRNA synthetase 2, mitochondrial
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128656.4-3088s1c1
Sequence:CCGGCCACCAGGAGACTGTAAGAAACTCGAGTTTCTTACAGTCTCCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128656.4-1529s1c1
Sequence:CCGGCCCAAGTATAACTACACTCTTCTCGAGAAGAGTGTAGTTATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128656.4-1653s1c1
Sequence:CCGGGTGGCCTCCTATTAGATAGAACTCGAGTTCTATCTAATAGGAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128656.4-1159s1c1
Sequence:CCGGTGAGAAGAACTCAGTCAAGATCTCGAGATCTTGACTGAGTTCTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_128656.4-695s1c2
Sequence:CCGGCAGCTGGTAGAGCTTTGGAATCTCGAGATTCCAAAGCTCTACCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020745
VALIDATED
AARS2 MISSION shRNA Bacterial Glycerol Stock
alanyl-tRNA synthetase 2, mitochondrial
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020745.1-133s1c1
Sequence:CCGGGCCGCCTTTCTGAACTTCTTTCTCGAGAAAGAAGTTCAGAAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020745.1-729s1c1
Sequence:CCGGCCTGGTCTTCATGCAACACAACTCGAGTTGTGTTGCATGAAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020745.1-2922s1c1
Sequence:CCGGCCTCAGTATAGCCCAAACCTACTCGAGTAGGTTTGGGCTATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020745.1-381s1c1
Sequence:CCGGCCATCATACCTTCTTTGAAATCTCGAGATTTCAAAGAAGGTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020745.2-133s21c1
Sequence:CCGGGCCGCCTTTCTGAACTTCTTTCTCGAGAAAGAAGTTCAGAAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020745.2-2922s21c1
Sequence:CCGGCCTCAGTATAGCCCAAACCTACTCGAGTAGGTTTGGGCTATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020745.2-381s21c1
Sequence:CCGGCCATCATACCTTCTTTGAAATCTCGAGATTTCAAAGAAGGTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020745.2-729s21c1
Sequence:CCGGCCTGGTCTTCATGCAACACAACTCGAGTTGTGTTGCATGAAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020745
VALIDATED
AARS2 MISSION shRNA shRNA Plasmid DNA
alanyl-tRNA synthetase 2, mitochondrial
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020745.1-133s1c1
Sequence:CCGGGCCGCCTTTCTGAACTTCTTTCTCGAGAAAGAAGTTCAGAAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020745.1-729s1c1
Sequence:CCGGCCTGGTCTTCATGCAACACAACTCGAGTTGTGTTGCATGAAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020745.1-2922s1c1
Sequence:CCGGCCTCAGTATAGCCCAAACCTACTCGAGTAGGTTTGGGCTATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020745.1-381s1c1
Sequence:CCGGCCATCATACCTTCTTTGAAATCTCGAGATTTCAAAGAAGGTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020745.2-133s21c1
Sequence:CCGGGCCGCCTTTCTGAACTTCTTTCTCGAGAAAGAAGTTCAGAAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020745.2-2922s21c1
Sequence:CCGGCCTCAGTATAGCCCAAACCTACTCGAGTAGGTTTGGGCTATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020745.2-381s21c1
Sequence:CCGGCCATCATACCTTCTTTGAAATCTCGAGATTTCAAAGAAGGTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020745.2-729s21c1
Sequence:CCGGCCTGGTCTTCATGCAACACAACTCGAGTTGTGTTGCATGAAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020745
VALIDATED
AARS2 MISSION shRNA Lentiviral Transduction Particles
alanyl-tRNA synthetase 2, mitochondrial
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_020745.1-133s1c1
Sequence:CCGGGCCGCCTTTCTGAACTTCTTTCTCGAGAAAGAAGTTCAGAAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020745.1-729s1c1
Sequence:CCGGCCTGGTCTTCATGCAACACAACTCGAGTTGTGTTGCATGAAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020745.1-2922s1c1
Sequence:CCGGCCTCAGTATAGCCCAAACCTACTCGAGTAGGTTTGGGCTATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020745.1-381s1c1
Sequence:CCGGCCATCATACCTTCTTTGAAATCTCGAGATTTCAAAGAAGGTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020745.2-133s21c1
Sequence:CCGGGCCGCCTTTCTGAACTTCTTTCTCGAGAAAGAAGTTCAGAAAGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_020745.2-2922s21c1
Sequence:CCGGCCTCAGTATAGCCCAAACCTACTCGAGTAGGTTTGGGCTATACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020745.2-381s21c1
Sequence:CCGGCCATCATACCTTCTTTGAAATCTCGAGATTTCAAAGAAGGTATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020745.2-729s21c1
Sequence:CCGGCCTGGTCTTCATGCAACACAACTCGAGTTGTGTTGCATGAAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks