EMAIL THIS PAGE TO A FRIEND

AARSD1

alanyl-tRNA synthetase domain containing 1

73 Gene Product Result for
UniProtKB ID: Q9BTE6, B4DI73
Gene ID:
Mouse(69684) alanyl-tRNA synthetase domain containing 1
Rat(619440) alanyl-tRNA synthetase domain containing 1
naked mole-rat(101708260) alanyl-tRNA synthetase domain containing 1
domestic guinea pig(100720960) alanyl-tRNA synthetase domain containing 1
sheep(101107295) alanyl-tRNA synthetase domain containing 1
Zebrafish(445178) alanyl-tRNA synthetase domain containing 1
dog(480510) alanyl-tRNA synthetase domain containing 1
domestic cat(101081013) alanyl-tRNA synthetase domain containing 1
cow(100125882) alanyl-tRNA synthetase domain containing 1
Horse(100052171) alanyl-tRNA synthetase domain containing 1
chicken(420013) alanyl-tRNA synthetase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025267 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025267 Rosetta Predictions human pricing
NM_001034109 Rosetta Predictions rat pricing
NM_144829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358119 predicted 453
2 SASI_Hs01_00143131 predicted 1146
3 SASI_Hs01_00143132 predicted 198
4 SASI_Hs01_00143134 predicted 876
5 SASI_Hs01_00143135 predicted 244
6 SASI_Hs01_00143136 predicted 932
7 SASI_Hs01_00143137 predicted 1495
8 SASI_Hs01_00143138 predicted 1186
9 SASI_Hs01_00143139 predicted 253
10 SASI_Hs02_00358120 predicted 1443
11 SASI_Hs01_00143130 predicted 660
12 SASI_Hs01_00143133 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119662 predicted 667
2 SASI_Rn01_00119663 predicted 955
3 SASI_Rn01_00119664 predicted 717
4 SASI_Rn01_00119665 predicted 1434
5 SASI_Rn01_00119666 predicted 1488
6 SASI_Rn01_00119668 predicted 1175
7 SASI_Rn01_00119669 predicted 1212
8 SASI_Rn01_00119670 predicted 1449
9 SASI_Rn02_00203949 predicted 1329
10 SASI_Rn01_00119671 predicted 976
11 SASI_Rn01_00119667 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139007 predicted 986
2 SASI_Mm01_00139008 predicted 420
3 SASI_Mm01_00139009 predicted 698
4 SASI_Mm01_00139010 predicted 790
5 SASI_Mm01_00139011 predicted 394
6 SASI_Mm01_00139012 predicted 216
7 SASI_Mm01_00139013 predicted 217
8 SASI_Mm01_00139014 predicted 494
9 SASI_Mm01_00139015 predicted 349
10 SASI_Mm01_00139016 predicted 690
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144829
VALIDATED
AARSD1 MISSION shRNA Bacterial Glycerol Stock
alanyl-tRNA synthetase domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-796s21c1
Sequence:CCGGGAGCGAAGTCATGGAAGTGAACTCGAGTTCACTTCCATGACTTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-502s21c1
Sequence:CCGGGCTATCGAGCAGAGTGTCAATCTCGAGATTGACACTCTGCTCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-700s21c1
Sequence:CCGGGACCTTCAGGTCATTAAGATTCTCGAGAATCTTAATGACCTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-147s21c1
Sequence:CCGGGAAAGAAGTGTTGAGCGGATTCTCGAGAATCCGCTCAACACTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-225s21c1
Sequence:CCGGCCGTGGTACCATCAATGACATCTCGAGATGTCATTGATGGTACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144829.1-502s1c1
Sequence:CCGGGCTATCGAGCAGAGTGTCAATCTCGAGATTGACACTCTGCTCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144829.1-147s1c1
Sequence:CCGGGAAAGAAGTGTTGAGCGGATTCTCGAGAATCCGCTCAACACTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144829.1-700s1c1
Sequence:CCGGGACCTTCAGGTCATTAAGATTCTCGAGAATCTTAATGACCTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144829.1-225s1c1
Sequence:CCGGCCGTGGTACCATCAATGACATCTCGAGATGTCATTGATGGTACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144829.1-796s1c1
Sequence:CCGGGAGCGAAGTCATGGAAGTGAACTCGAGTTCACTTCCATGACTTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144829
VALIDATED
AARSD1 MISSION shRNA shRNA Plasmid DNA
alanyl-tRNA synthetase domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-796s21c1
Sequence:CCGGGAGCGAAGTCATGGAAGTGAACTCGAGTTCACTTCCATGACTTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-502s21c1
Sequence:CCGGGCTATCGAGCAGAGTGTCAATCTCGAGATTGACACTCTGCTCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-700s21c1
Sequence:CCGGGACCTTCAGGTCATTAAGATTCTCGAGAATCTTAATGACCTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-147s21c1
Sequence:CCGGGAAAGAAGTGTTGAGCGGATTCTCGAGAATCCGCTCAACACTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-225s21c1
Sequence:CCGGCCGTGGTACCATCAATGACATCTCGAGATGTCATTGATGGTACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144829.1-502s1c1
Sequence:CCGGGCTATCGAGCAGAGTGTCAATCTCGAGATTGACACTCTGCTCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144829.1-147s1c1
Sequence:CCGGGAAAGAAGTGTTGAGCGGATTCTCGAGAATCCGCTCAACACTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144829.1-700s1c1
Sequence:CCGGGACCTTCAGGTCATTAAGATTCTCGAGAATCTTAATGACCTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144829.1-225s1c1
Sequence:CCGGCCGTGGTACCATCAATGACATCTCGAGATGTCATTGATGGTACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144829.1-796s1c1
Sequence:CCGGGAGCGAAGTCATGGAAGTGAACTCGAGTTCACTTCCATGACTTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144829
VALIDATED
AARSD1 MISSION shRNA Lentiviral Transduction Particles
alanyl-tRNA synthetase domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-796s21c1
Sequence:CCGGGAGCGAAGTCATGGAAGTGAACTCGAGTTCACTTCCATGACTTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-502s21c1
Sequence:CCGGGCTATCGAGCAGAGTGTCAATCTCGAGATTGACACTCTGCTCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-700s21c1
Sequence:CCGGGACCTTCAGGTCATTAAGATTCTCGAGAATCTTAATGACCTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-147s21c1
Sequence:CCGGGAAAGAAGTGTTGAGCGGATTCTCGAGAATCCGCTCAACACTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144829.1-225s21c1
Sequence:CCGGCCGTGGTACCATCAATGACATCTCGAGATGTCATTGATGGTACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144829.1-502s1c1
Sequence:CCGGGCTATCGAGCAGAGTGTCAATCTCGAGATTGACACTCTGCTCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144829.1-147s1c1
Sequence:CCGGGAAAGAAGTGTTGAGCGGATTCTCGAGAATCCGCTCAACACTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144829.1-700s1c1
Sequence:CCGGGACCTTCAGGTCATTAAGATTCTCGAGAATCTTAATGACCTGAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144829.1-225s1c1
Sequence:CCGGCCGTGGTACCATCAATGACATCTCGAGATGTCATTGATGGTACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144829.1-796s1c1
Sequence:CCGGGAGCGAAGTCATGGAAGTGAACTCGAGTTCACTTCCATGACTTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025267
VALIDATED
AARSD1 MISSION shRNA Bacterial Glycerol Stock
alanyl-tRNA synthetase domain containing 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_025267.3-1183s21c1
Sequence:CCGGGAACAGAACCAACCTGATATTCTCGAGAATATCAGGTTGGTTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025267.3-294s21c1
Sequence:CCGGAGCGCTCTTCCCGCTCTATTACTCGAGTAATAGAGCGGGAAGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025267.3-834s21c1
Sequence:CCGGCAGTTGCTGACCATCTATTTACTCGAGTAAATAGATGGTCAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025267.3-171s21c1
Sequence:CCGGCCGATGTCCACGTGCTTATTGCTCGAGCAATAAGCACGTGGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_025267.3-859s21c1
Sequence:CCGGGAAGACAACATCATGGGAGTTCTCGAGAACTCCCATGATGTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_025267.2-859s1c1
Sequence:CCGGGAAGACAACATCATGGGAGTTCTCGAGAACTCCCATGATGTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_025267.2-1183s1c1
Sequence:CCGGGAACAGAACCAACCTGATATTCTCGAGAATATCAGGTTGGTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_025267.2-834s1c1
Sequence:CCGGCAGTTGCTGACCATCTATTTACTCGAGTAAATAGATGGTCAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_025267.2-1339s1c1
Sequence:CCGGGCAGAAGAATAACCTGAATCTCTCGAGAGATTCAGGTTATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025267.2-248s1c1
Sequence:CCGGGAGATTGAGTTCTATGCCAAACTCGAGTTTGGCATAGAACTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025267.2-833s1c1
Sequence:CCGGGCAGTTGCTGACCATCTATTTCTCGAGAAATAGATGGTCAGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025267.2-1195s1c1
Sequence:CCGGCCTGATATTTCTGTCTGGGAACTCGAGTTCCCAGACAGAAATATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025267
VALIDATED
AARSD1 MISSION shRNA shRNA Plasmid DNA
alanyl-tRNA synthetase domain containing 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_025267.3-1183s21c1
Sequence:CCGGGAACAGAACCAACCTGATATTCTCGAGAATATCAGGTTGGTTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025267.3-294s21c1
Sequence:CCGGAGCGCTCTTCCCGCTCTATTACTCGAGTAATAGAGCGGGAAGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025267.3-834s21c1
Sequence:CCGGCAGTTGCTGACCATCTATTTACTCGAGTAAATAGATGGTCAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025267.3-171s21c1
Sequence:CCGGCCGATGTCCACGTGCTTATTGCTCGAGCAATAAGCACGTGGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_025267.3-859s21c1
Sequence:CCGGGAAGACAACATCATGGGAGTTCTCGAGAACTCCCATGATGTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_025267.2-859s1c1
Sequence:CCGGGAAGACAACATCATGGGAGTTCTCGAGAACTCCCATGATGTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_025267.2-1183s1c1
Sequence:CCGGGAACAGAACCAACCTGATATTCTCGAGAATATCAGGTTGGTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_025267.2-834s1c1
Sequence:CCGGCAGTTGCTGACCATCTATTTACTCGAGTAAATAGATGGTCAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_025267.2-1339s1c1
Sequence:CCGGGCAGAAGAATAACCTGAATCTCTCGAGAGATTCAGGTTATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025267.2-248s1c1
Sequence:CCGGGAGATTGAGTTCTATGCCAAACTCGAGTTTGGCATAGAACTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025267.2-833s1c1
Sequence:CCGGGCAGTTGCTGACCATCTATTTCTCGAGAAATAGATGGTCAGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025267.2-1195s1c1
Sequence:CCGGCCTGATATTTCTGTCTGGGAACTCGAGTTCCCAGACAGAAATATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025267
VALIDATED
AARSD1 MISSION shRNA Lentiviral Transduction Particles
alanyl-tRNA synthetase domain containing 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_025267.3-1183s21c1
Sequence:CCGGGAACAGAACCAACCTGATATTCTCGAGAATATCAGGTTGGTTCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025267.3-294s21c1
Sequence:CCGGAGCGCTCTTCCCGCTCTATTACTCGAGTAATAGAGCGGGAAGAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025267.3-834s21c1
Sequence:CCGGCAGTTGCTGACCATCTATTTACTCGAGTAAATAGATGGTCAGCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025267.3-171s21c1
Sequence:CCGGCCGATGTCCACGTGCTTATTGCTCGAGCAATAAGCACGTGGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_025267.3-859s21c1
Sequence:CCGGGAAGACAACATCATGGGAGTTCTCGAGAACTCCCATGATGTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_025267.2-859s1c1
Sequence:CCGGGAAGACAACATCATGGGAGTTCTCGAGAACTCCCATGATGTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_025267.2-1183s1c1
Sequence:CCGGGAACAGAACCAACCTGATATTCTCGAGAATATCAGGTTGGTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_025267.2-834s1c1
Sequence:CCGGCAGTTGCTGACCATCTATTTACTCGAGTAAATAGATGGTCAGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_025267.2-1339s1c1
Sequence:CCGGGCAGAAGAATAACCTGAATCTCTCGAGAGATTCAGGTTATTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025267.2-248s1c1
Sequence:CCGGGAGATTGAGTTCTATGCCAAACTCGAGTTTGGCATAGAACTCAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025267.2-833s1c1
Sequence:CCGGGCAGTTGCTGACCATCTATTTCTCGAGAAATAGATGGTCAGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025267.2-1195s1c1
Sequence:CCGGCCTGATATTTCTGTCTGGGAACTCGAGTTCCCAGACAGAAATATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks