EMAIL THIS PAGE TO A FRIEND

AASDH

aminoadipate-semialdehyde dehydrogenase

Synonyms: ACSF4 LYS2 NRPS1098 NRPS998
Gene ID:
Mouse(231326) aminoadipate-semialdehyde dehydrogenase
Rat(364136) aminoadipate-semialdehyde dehydrogenase
Zebrafish(570338) aminoadipate-semialdehyde dehydrogenase
cow(782093) aminoadipate-semialdehyde dehydrogenase
Horse(100053858) aminoadipate-semialdehyde dehydrogenase
domestic cat(101085204) aminoadipate-semialdehyde dehydrogenase
dog(482159) aminoadipate-semialdehyde dehydrogenase
chicken(422744) aminoadipate-semialdehyde dehydrogenase
sheep(101108833) aminoadipate-semialdehyde dehydrogenase
Domestic Rabbit(100343993) aminoadipate-semialdehyde dehydrogenase
domestic guinea pig(100729920) aminoadipate-semialdehyde dehydrogenase
naked mole-rat(101722777) aminoadipate-semialdehyde dehydrogenase
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181806 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181806 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181806 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181806 Rosetta Predictions human pricing
XM_344230 Rosetta Predictions rat pricing
XR_009058 Rosetta Predictions rat pricing
NM_173765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370407 predicted 1195
2 SASI_Hs01_00165374 predicted 261
3 SASI_Hs01_00165376 predicted 251
4 SASI_Hs02_00370408 predicted 1229
5 SASI_Hs01_00165378 predicted 2764
6 SASI_Hs02_00370409 predicted 2804
7 SASI_Hs01_00165379 predicted 2995
8 SASI_Hs01_00165380 predicted 3187
9 SASI_Hs01_00165381 predicted 1824
10 SASI_Hs01_00165382 predicted 3151
11 SASI_Hs01_00165375 predicted 1882
12 SASI_Hs01_00165377 predicted 2168
13 SASI_Hs01_00165383 predicted 2646
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396961 predicted 3011
2 SASI_Rn02_00396962 predicted 3057
3 SASI_Rn02_00396963 predicted 3159
4 SASI_Rn02_00396964 predicted 3105
5 SASI_Rn02_00396965 predicted 3042
6 SASI_Rn02_00396966 predicted 3054
7 SASI_Rn02_00396967 predicted 3057
8 SASI_Rn02_00396968 predicted 3106
9 SASI_Rn02_00396969 predicted 3124
10 SASI_Rn02_00396970 predicted 3125
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009058 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160971 predicted 3028
2 SASI_Rn01_00160972 predicted 3066
3 SASI_Rn01_00160973 predicted 3172
4 SASI_Rn01_00160974 predicted 3119
5 SASI_Rn01_00160975 predicted 3057
6 SASI_Rn01_00160976 predicted 3068
7 SASI_Rn01_00160977 predicted 3069
8 SASI_Rn01_00160978 predicted 3119
9 SASI_Rn01_00160979 predicted 3139
10 SASI_Rn02_00418641 predicted 3143
11 SASI_Rn01_00160980 predicted 3154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110215 predicted 2176
2 SASI_Mm01_00110216 predicted 1325
3 SASI_Mm02_00345421 predicted 354
4 SASI_Mm01_00110217 predicted 2978
5 SASI_Mm01_00110219 predicted 3336
6 SASI_Mm01_00110220 predicted 1352
7 SASI_Mm01_00110221 predicted 679
8 SASI_Mm01_00110222 predicted 2924
9 SASI_Mm01_00110223 predicted 406
10 SASI_Mm01_00110224 predicted 1896
11 SASI_Mm01_00110218 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173765
AASDH MISSION shRNA Bacterial Glycerol Stock
aminoadipate-semialdehyde dehydrogenase
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173765.1-600s1c1
Sequence:CCGGCGTCCTTATCAACTTACTTTACTCGAGTAAAGTAAGTTGATAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173765.1-2913s1c1
Sequence:CCGGCAGGACTCATTTATGTCGGATCTCGAGATCCGACATAAATGAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173765.1-632s1c1
Sequence:CCGGGACCTAAAGTATGTTCTCGTTCTCGAGAACGAGAACATACTTTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173765.1-2182s1c1
Sequence:CCGGCTTAGACGTTTACAACCACATCTCGAGATGTGGTTGTAAACGTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173765.1-3535s1c1
Sequence:CCGGCTGGGAATCAATGCTTGTTATCTCGAGATAACAAGCATTGATTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173765.2-2460s1c1
Sequence:CCGGGACTAACACTCAGATATTAAACTCGAGTTTAATATCTGAGTGTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173765
AASDH MISSION shRNA shRNA Plasmid DNA
aminoadipate-semialdehyde dehydrogenase
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173765.1-600s1c1
Sequence:CCGGCGTCCTTATCAACTTACTTTACTCGAGTAAAGTAAGTTGATAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173765.1-2913s1c1
Sequence:CCGGCAGGACTCATTTATGTCGGATCTCGAGATCCGACATAAATGAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173765.1-632s1c1
Sequence:CCGGGACCTAAAGTATGTTCTCGTTCTCGAGAACGAGAACATACTTTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173765.1-2182s1c1
Sequence:CCGGCTTAGACGTTTACAACCACATCTCGAGATGTGGTTGTAAACGTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173765.1-3535s1c1
Sequence:CCGGCTGGGAATCAATGCTTGTTATCTCGAGATAACAAGCATTGATTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173765.2-2460s1c1
Sequence:CCGGGACTAACACTCAGATATTAAACTCGAGTTTAATATCTGAGTGTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173765
AASDH MISSION shRNA Lentiviral Transduction Particles
aminoadipate-semialdehyde dehydrogenase
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173765.1-600s1c1
Sequence:CCGGCGTCCTTATCAACTTACTTTACTCGAGTAAAGTAAGTTGATAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173765.1-2913s1c1
Sequence:CCGGCAGGACTCATTTATGTCGGATCTCGAGATCCGACATAAATGAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173765.1-632s1c1
Sequence:CCGGGACCTAAAGTATGTTCTCGTTCTCGAGAACGAGAACATACTTTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173765.1-2182s1c1
Sequence:CCGGCTTAGACGTTTACAACCACATCTCGAGATGTGGTTGTAAACGTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173765.1-3535s1c1
Sequence:CCGGCTGGGAATCAATGCTTGTTATCTCGAGATAACAAGCATTGATTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173765.2-2460s1c1
Sequence:CCGGGACTAACACTCAGATATTAAACTCGAGTTTAATATCTGAGTGTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181806
VALIDATED
AASDH MISSION shRNA Bacterial Glycerol Stock
aminoadipate-semialdehyde dehydrogenase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_181806.2-725s1c1
Sequence:CCGGGCTTAGCCTATGTTCTACATACTCGAGTATGTAGAACATAGGCTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181806.2-2466s1c1
Sequence:CCGGGCTGGTTGTAATACCCACTTTCTCGAGAAAGTGGGTATTACAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_181806.2-3271s1c1
Sequence:CCGGGCAGCATCTACTGATGGGAAACTCGAGTTTCCCATCAGTAGATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_181806.2-989s1c1
Sequence:CCGGCCCATCATAGAGTGACTGTTTCTCGAGAAACAGTCACTCTATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181806.2-3421s1c1
Sequence:CCGGCTGGATTTATTGGGTGGCAATCTCGAGATTGCCACCCAATAAATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181806.2-432s21c1
Sequence:CCGGACCGTCATTATCAACTCATTTCTCGAGAAATGAGTTGATAATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_181806.2-1199s21c1
Sequence:CCGGTATCAAGTTGGGCGACCATTTCTCGAGAAATGGTCGCCCAACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_181806.2-1568s21c1
Sequence:CCGGGTGCAGTTACATGGTATAATCCTCGAGGATTATACCATGTAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_181806.2-1077s21c1
Sequence:CCGGCACTACTTCTCTTCGAGTATTCTCGAGAATACTCGAAGAGAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_181806.2-2927s21c1
Sequence:CCGGCTGCTACTGGGAACGTTATTTCTCGAGAAATAACGTTCCCAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181806
VALIDATED
AASDH MISSION shRNA shRNA Plasmid DNA
aminoadipate-semialdehyde dehydrogenase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_181806.2-725s1c1
Sequence:CCGGGCTTAGCCTATGTTCTACATACTCGAGTATGTAGAACATAGGCTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181806.2-2466s1c1
Sequence:CCGGGCTGGTTGTAATACCCACTTTCTCGAGAAAGTGGGTATTACAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_181806.2-3271s1c1
Sequence:CCGGGCAGCATCTACTGATGGGAAACTCGAGTTTCCCATCAGTAGATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_181806.2-989s1c1
Sequence:CCGGCCCATCATAGAGTGACTGTTTCTCGAGAAACAGTCACTCTATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181806.2-3421s1c1
Sequence:CCGGCTGGATTTATTGGGTGGCAATCTCGAGATTGCCACCCAATAAATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181806.2-432s21c1
Sequence:CCGGACCGTCATTATCAACTCATTTCTCGAGAAATGAGTTGATAATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_181806.2-1199s21c1
Sequence:CCGGTATCAAGTTGGGCGACCATTTCTCGAGAAATGGTCGCCCAACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_181806.2-1568s21c1
Sequence:CCGGGTGCAGTTACATGGTATAATCCTCGAGGATTATACCATGTAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_181806.2-1077s21c1
Sequence:CCGGCACTACTTCTCTTCGAGTATTCTCGAGAATACTCGAAGAGAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_181806.2-2927s21c1
Sequence:CCGGCTGCTACTGGGAACGTTATTTCTCGAGAAATAACGTTCCCAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181806
VALIDATED
AASDH MISSION shRNA Lentiviral Transduction Particles
aminoadipate-semialdehyde dehydrogenase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_181806.2-725s1c1
Sequence:CCGGGCTTAGCCTATGTTCTACATACTCGAGTATGTAGAACATAGGCTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181806.2-2466s1c1
Sequence:CCGGGCTGGTTGTAATACCCACTTTCTCGAGAAAGTGGGTATTACAACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_181806.2-3271s1c1
Sequence:CCGGGCAGCATCTACTGATGGGAAACTCGAGTTTCCCATCAGTAGATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_181806.2-989s1c1
Sequence:CCGGCCCATCATAGAGTGACTGTTTCTCGAGAAACAGTCACTCTATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181806.2-3421s1c1
Sequence:CCGGCTGGATTTATTGGGTGGCAATCTCGAGATTGCCACCCAATAAATCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181806.2-432s21c1
Sequence:CCGGACCGTCATTATCAACTCATTTCTCGAGAAATGAGTTGATAATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_181806.2-1199s21c1
Sequence:CCGGTATCAAGTTGGGCGACCATTTCTCGAGAAATGGTCGCCCAACTTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_181806.2-1568s21c1
Sequence:CCGGGTGCAGTTACATGGTATAATCCTCGAGGATTATACCATGTAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_181806.2-1077s21c1
Sequence:CCGGCACTACTTCTCTTCGAGTATTCTCGAGAATACTCGAAGAGAAGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_181806.2-2927s21c1
Sequence:CCGGCTGCTACTGGGAACGTTATTTCTCGAGAAATAACGTTCCCAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks