EMAIL THIS PAGE TO A FRIEND

AASDHPPT

aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase

Synonyms: AASD-PPT LYS2 LYS5
UniProtKB ID: Q9NRN7, B2R6D1, Q9C068, Q9P0Q3, Q9UG80, Q9Y389
Gene ID:
Human(60496) Summary: The protein encoded by this gene is similar to Saccharomyces cerevisiae LYS5, which is required for the activation of the alpha-aminoadipate dehydrogenase in the biosynthetic pathway of lysine. Yeast alpha-aminoadipate dehydrogenase converts alpha-biosynthetic-aminoadipate semialdehyde to alpha-aminoadipate. It has been suggested that defects in the human gene result in pipecolic acidemia. [provided by RefSeq, Jul 2008]
Mouse(67618) aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Rat(300328) aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
naked mole-rat(101701763) aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
domestic guinea pig(100731306) aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
sheep(101115306) aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Zebrafish(619247) aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
cow(519816) aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
domestic cat(101098739) aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
dog(489426) aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
chicken(418975) aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015423 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026276 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026276 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026276 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015423 Rosetta Predictions human pricing
NM_001106798 Rosetta Predictions rat pricing
XM_217078 Rosetta Predictions rat pricing
NM_026276 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206792 predicted 619
2 SASI_Hs01_00206793 predicted 676
3 SASI_Hs01_00206794 predicted 555
4 SASI_Hs01_00206795 predicted 763
5 SASI_Hs01_00206796 predicted 694
6 SASI_Hs02_00347804 predicted 677
7 SASI_Hs01_00206798 predicted 298
8 SASI_Hs02_00347805 predicted 373
9 SASI_Hs01_00206799 predicted 520
10 SASI_Hs01_00206800 predicted 416
11 SASI_Hs01_00206797 predicted 912
12 SASI_Hs01_00206801 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106798 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222508 predicted 980
2 SASI_Rn02_00222509 predicted 856
3 SASI_Rn02_00222510 predicted 810
4 SASI_Rn02_00222511 predicted 640
5 SASI_Rn02_00222512 predicted 922
6 SASI_Rn02_00222513 predicted 897
7 SASI_Rn02_00222514 predicted 911
8 SASI_Rn02_00222515 predicted 740
9 SASI_Rn02_00222516 predicted 892
10 SASI_Rn02_00222517 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181793 predicted 537
2 SASI_Rn01_00181794 predicted 489
3 SASI_Rn01_00181795 predicted 650
4 SASI_Rn01_00181796 predicted 756
5 SASI_Rn01_00181797 predicted 619
6 SASI_Rn01_00181798 predicted 412
7 SASI_Rn01_00181799 predicted 271
8 SASI_Rn01_00181800 predicted 830
9 SASI_Rn01_00181801 predicted 713
10 SASI_Rn01_00181802 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112184 predicted 992
2 SASI_Mm01_00112185 predicted 320
3 SASI_Mm01_00112186 predicted 946
4 SASI_Mm01_00112187 predicted 647
5 SASI_Mm01_00112188 predicted 361
6 SASI_Mm01_00112189 predicted 452
7 SASI_Mm01_00112190 predicted 313
8 SASI_Mm01_00112191 predicted 946
9 SASI_Mm01_00112192 predicted 213
10 SASI_Mm01_00112193 predicted 869
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015423
VALIDATED
AASDHPPT MISSION shRNA Bacterial Glycerol Stock
aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-336s21c1
Sequence:CCGGCGTCTGATGATAAGGAAATTACTCGAGTAATTTCCTTATCATCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-515s21c1
Sequence:CCGGGCTGCAAGTTGGAATTGATATCTCGAGATATCAATTCCAACTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-452s21c1
Sequence:CCGGCCCGAATTTCAACTTTAACATCTCGAGATGTTAAAGTTGAAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-703s21c1
Sequence:CCGGCCATTGGTGTTGGACTAGGATCTCGAGATCCTAGTCCAACACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-944s21c1
Sequence:CCGGGAGGCAATTTACTATTCTCAACTCGAGTTGAGAATAGTAAATTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015423.2-703s1c1
Sequence:CCGGCCATTGGTGTTGGACTAGGATCTCGAGATCCTAGTCCAACACCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015423.2-515s1c1
Sequence:CCGGGCTGCAAGTTGGAATTGATATCTCGAGATATCAATTCCAACTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015423.2-452s1c1
Sequence:CCGGCCCGAATTTCAACTTTAACATCTCGAGATGTTAAAGTTGAAATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015423.2-336s1c1
Sequence:CCGGCGTCTGATGATAAGGAAATTACTCGAGTAATTTCCTTATCATCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015423.2-944s1c1
Sequence:CCGGGAGGCAATTTACTATTCTCAACTCGAGTTGAGAATAGTAAATTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015423
VALIDATED
AASDHPPT MISSION shRNA shRNA Plasmid DNA
aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-336s21c1
Sequence:CCGGCGTCTGATGATAAGGAAATTACTCGAGTAATTTCCTTATCATCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-515s21c1
Sequence:CCGGGCTGCAAGTTGGAATTGATATCTCGAGATATCAATTCCAACTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-452s21c1
Sequence:CCGGCCCGAATTTCAACTTTAACATCTCGAGATGTTAAAGTTGAAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-703s21c1
Sequence:CCGGCCATTGGTGTTGGACTAGGATCTCGAGATCCTAGTCCAACACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-944s21c1
Sequence:CCGGGAGGCAATTTACTATTCTCAACTCGAGTTGAGAATAGTAAATTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015423.2-703s1c1
Sequence:CCGGCCATTGGTGTTGGACTAGGATCTCGAGATCCTAGTCCAACACCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015423.2-515s1c1
Sequence:CCGGGCTGCAAGTTGGAATTGATATCTCGAGATATCAATTCCAACTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015423.2-452s1c1
Sequence:CCGGCCCGAATTTCAACTTTAACATCTCGAGATGTTAAAGTTGAAATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015423.2-336s1c1
Sequence:CCGGCGTCTGATGATAAGGAAATTACTCGAGTAATTTCCTTATCATCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015423.2-944s1c1
Sequence:CCGGGAGGCAATTTACTATTCTCAACTCGAGTTGAGAATAGTAAATTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015423
VALIDATED
AASDHPPT MISSION shRNA Lentiviral Transduction Particles
aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-336s21c1
Sequence:CCGGCGTCTGATGATAAGGAAATTACTCGAGTAATTTCCTTATCATCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-515s21c1
Sequence:CCGGGCTGCAAGTTGGAATTGATATCTCGAGATATCAATTCCAACTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-452s21c1
Sequence:CCGGCCCGAATTTCAACTTTAACATCTCGAGATGTTAAAGTTGAAATTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-703s21c1
Sequence:CCGGCCATTGGTGTTGGACTAGGATCTCGAGATCCTAGTCCAACACCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015423.2-944s21c1
Sequence:CCGGGAGGCAATTTACTATTCTCAACTCGAGTTGAGAATAGTAAATTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015423.2-703s1c1
Sequence:CCGGCCATTGGTGTTGGACTAGGATCTCGAGATCCTAGTCCAACACCAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015423.2-515s1c1
Sequence:CCGGGCTGCAAGTTGGAATTGATATCTCGAGATATCAATTCCAACTTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015423.2-452s1c1
Sequence:CCGGCCCGAATTTCAACTTTAACATCTCGAGATGTTAAAGTTGAAATTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015423.2-336s1c1
Sequence:CCGGCGTCTGATGATAAGGAAATTACTCGAGTAATTTCCTTATCATCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015423.2-944s1c1
Sequence:CCGGGAGGCAATTTACTATTCTCAACTCGAGTTGAGAATAGTAAATTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026276
VALIDATED
AASDHPPT MISSION shRNA Bacterial Glycerol Stock
aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026276.1-486s1c1
Sequence:CCGGGTGGGAAACAATCAGAAGTTTCTCGAGAAACTTCTGATTGTTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026276.1-625s1c1
Sequence:CCGGTCTCCATTAAACATGGACATTCTCGAGAATGTCCATGTTTAATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026276.1-428s1c1
Sequence:CCGGGTCGTGGTTCAATTCCAGAATCTCGAGATTCTGGAATTGAACCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026276.1-816s1c1
Sequence:CCGGGAGGAAGTTTACCATTCTTAACTCGAGTTAAGAATGGTAAACTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026276.1-298s1c1
Sequence:CCGGCTTGCGAAAGACTCGTTGAATCTCGAGATTCAACGAGTCTTTCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026276
VALIDATED
AASDHPPT MISSION shRNA shRNA Plasmid DNA
aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026276.1-486s1c1
Sequence:CCGGGTGGGAAACAATCAGAAGTTTCTCGAGAAACTTCTGATTGTTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026276.1-625s1c1
Sequence:CCGGTCTCCATTAAACATGGACATTCTCGAGAATGTCCATGTTTAATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026276.1-428s1c1
Sequence:CCGGGTCGTGGTTCAATTCCAGAATCTCGAGATTCTGGAATTGAACCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026276.1-816s1c1
Sequence:CCGGGAGGAAGTTTACCATTCTTAACTCGAGTTAAGAATGGTAAACTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026276.1-298s1c1
Sequence:CCGGCTTGCGAAAGACTCGTTGAATCTCGAGATTCAACGAGTCTTTCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026276
VALIDATED
AASDHPPT MISSION shRNA Lentiviral Transduction Particles
aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026276.1-486s1c1
Sequence:CCGGGTGGGAAACAATCAGAAGTTTCTCGAGAAACTTCTGATTGTTTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026276.1-625s1c1
Sequence:CCGGTCTCCATTAAACATGGACATTCTCGAGAATGTCCATGTTTAATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026276.1-428s1c1
Sequence:CCGGGTCGTGGTTCAATTCCAGAATCTCGAGATTCTGGAATTGAACCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026276.1-816s1c1
Sequence:CCGGGAGGAAGTTTACCATTCTTAACTCGAGTTAAGAATGGTAAACTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026276.1-298s1c1
Sequence:CCGGCTTGCGAAAGACTCGTTGAATCTCGAGATTCAACGAGTCTTTCGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks