EMAIL THIS PAGE TO A FRIEND

AASS

aminoadipate-semialdehyde synthase

53 Gene Product Result for
Synonyms: LKR/SDH LKRSDH LORSDH
UniProtKB ID: Q9UDR5, O95462
Gene ID:
Human(10157) Summary: This gene encodes a bifunctional enzyme that catalyzes the first two steps in the mammalian lysine degradation pathway. The N-terminal and the C-terminal portions of this enzyme contain lysine-ketoglutarate reductase and saccharopine dehydrogenase activity, respectively, resulting in the conversion of lysine to alpha-aminoadipic semialdehyde. Mutations in this gene are associated with familial hyperlysinemia. [provided by RefSeq, Jul 2008]
Mouse(30956) aminoadipate-semialdehyde synthase
Rat(296925) aminoadipate-semialdehyde synthase
Zebrafish(556229) aminoadipate-semialdehyde synthase
domestic cat(101091272) aminoadipate-semialdehyde synthase
cow(520865) aminoadipate-semialdehyde synthase
Horse(100056260) aminoadipate-semialdehyde synthase
dog(482429) aminoadipate-semialdehyde synthase
chicken(417757) aminoadipate-semialdehyde synthase
sheep(101103973) aminoadipate-semialdehyde synthase
Domestic Rabbit(100352070) aminoadipate-semialdehyde synthase
domestic guinea pig(100722098) aminoadipate-semialdehyde synthase
naked mole-rat(101707268) aminoadipate-semialdehyde synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005763 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013930 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013930 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013930 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005763 Rosetta Predictions human pricing
NM_001100963 Rosetta Predictions rat pricing
NM_013930 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340239 predicted 2027
2 SASI_Hs01_00016127 predicted 1333
3 SASI_Hs01_00016128 predicted 1239
4 SASI_Hs01_00016129 predicted 1186
5 SASI_Hs02_00340240 predicted 1826
6 SASI_Hs01_00016130 predicted 994
7 SASI_Hs01_00016131 predicted 1172
8 SASI_Hs01_00016134 predicted 1563
9 SASI_Hs01_00016135 predicted 728
10 SASI_Hs01_00016136 predicted 920
11 SASI_Hs01_00016132 predicted 1598
12 SASI_Hs01_00016133 predicted 1677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210772 predicted 2119
2 SASI_Rn02_00210773 predicted 1192
3 SASI_Rn02_00210774 predicted 434
4 SASI_Rn02_00210775 predicted 1318
5 SASI_Rn02_00210776 predicted 1875
6 SASI_Rn02_00210777 predicted 1740
7 SASI_Rn02_00210778 predicted 1833
8 SASI_Rn02_00210779 predicted 1535
9 SASI_Rn02_00210780 predicted 2892
10 SASI_Rn02_00210781 predicted 2112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013930 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132650 predicted 2395
2 SASI_Mm01_00132651 predicted 1880
3 SASI_Mm01_00132652 predicted 1324
4 SASI_Mm01_00132653 predicted 1250
5 SASI_Mm02_00323029 predicted 2961
6 SASI_Mm01_00132654 predicted 932
7 SASI_Mm01_00132656 predicted 2668
8 SASI_Mm01_00132657 predicted 604
9 SASI_Mm01_00132658 predicted 2180
10 SASI_Mm01_00132659 predicted 837
11 SASI_Mm01_00132655 predicted 1461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005763
AASS MISSION shRNA Bacterial Glycerol Stock
aminoadipate-semialdehyde synthase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-1132s1c1
Sequence:CCGGCCACACAAACTCGTGGCAATACTCGAGTATTGCCACGAGTTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-1452s1c1
Sequence:CCGGCGGTACATTACCTGATAAATACTCGAGTATTTATCAGGTAATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-1562s1c1
Sequence:CCGGGCTACATATCTGAGCCTGTATCTCGAGATACAGGCTCAGATATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-1966s1c1
Sequence:CCGGGCCACGATTGAATCATATATTCTCGAGAATATATGATTCAATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-490s1c1
Sequence:CCGGCGCCTTATTGATTATGAGAAACTCGAGTTTCTCATAATCAATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005763.2-2850s21c1
Sequence:CCGGTACTACACAGAGTACAATTAACTCGAGTTAATTGTACTCTGTGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005763.2-2811s21c1
Sequence:GTACCGGACCAATATTGGAGCGAATTAACTCGAGTTAATTCGCTCCAATATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005763.2-1592s21c1
Sequence:GTACCGGTATCAAGAGATGGCAATATAGCTCGAGCTATATTGCCATCTCTTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005763.2-3061s21c1
Sequence:CCGGCCACTAACAGAGAACTTTAATCTCGAGATTAAAGTTCTCTGTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005763.2-1449s21c1
Sequence:CCGGCAACGGTACATTACCTGATAACTCGAGTTATCAGGTAATGTACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005763
AASS MISSION shRNA shRNA Plasmid DNA
aminoadipate-semialdehyde synthase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-1132s1c1
Sequence:CCGGCCACACAAACTCGTGGCAATACTCGAGTATTGCCACGAGTTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-1452s1c1
Sequence:CCGGCGGTACATTACCTGATAAATACTCGAGTATTTATCAGGTAATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-1562s1c1
Sequence:CCGGGCTACATATCTGAGCCTGTATCTCGAGATACAGGCTCAGATATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-1966s1c1
Sequence:CCGGGCCACGATTGAATCATATATTCTCGAGAATATATGATTCAATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-490s1c1
Sequence:CCGGCGCCTTATTGATTATGAGAAACTCGAGTTTCTCATAATCAATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005763.2-2850s21c1
Sequence:CCGGTACTACACAGAGTACAATTAACTCGAGTTAATTGTACTCTGTGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005763.2-2811s21c1
Sequence:GTACCGGACCAATATTGGAGCGAATTAACTCGAGTTAATTCGCTCCAATATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005763.2-1592s21c1
Sequence:GTACCGGTATCAAGAGATGGCAATATAGCTCGAGCTATATTGCCATCTCTTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005763.2-3061s21c1
Sequence:CCGGCCACTAACAGAGAACTTTAATCTCGAGATTAAAGTTCTCTGTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005763.2-1449s21c1
Sequence:CCGGCAACGGTACATTACCTGATAACTCGAGTTATCAGGTAATGTACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005763
AASS MISSION shRNA Lentiviral Transduction Particles
aminoadipate-semialdehyde synthase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-1132s1c1
Sequence:CCGGCCACACAAACTCGTGGCAATACTCGAGTATTGCCACGAGTTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-1452s1c1
Sequence:CCGGCGGTACATTACCTGATAAATACTCGAGTATTTATCAGGTAATGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-1562s1c1
Sequence:CCGGGCTACATATCTGAGCCTGTATCTCGAGATACAGGCTCAGATATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-1966s1c1
Sequence:CCGGGCCACGATTGAATCATATATTCTCGAGAATATATGATTCAATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005763.2-490s1c1
Sequence:CCGGCGCCTTATTGATTATGAGAAACTCGAGTTTCTCATAATCAATAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005763.2-2850s21c1
Sequence:CCGGTACTACACAGAGTACAATTAACTCGAGTTAATTGTACTCTGTGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005763.2-2811s21c1
Sequence:GTACCGGACCAATATTGGAGCGAATTAACTCGAGTTAATTCGCTCCAATATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005763.2-1592s21c1
Sequence:GTACCGGTATCAAGAGATGGCAATATAGCTCGAGCTATATTGCCATCTCTTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005763.2-3061s21c1
Sequence:CCGGCCACTAACAGAGAACTTTAATCTCGAGATTAAAGTTCTCTGTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005763.2-1449s21c1
Sequence:CCGGCAACGGTACATTACCTGATAACTCGAGTTATCAGGTAATGTACCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013930
VALIDATED
AASS MISSION shRNA Bacterial Glycerol Stock
aminoadipate-semialdehyde synthase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013930.2-501s1c1
Sequence:CCGGCGGCTCATTGATTATGAGAAACTCGAGTTTCTCATAATCAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013930.2-948s1c1
Sequence:CCGGCCCGTAGAATACGAGAAATATCTCGAGATATTTCTCGTATTCTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013930.2-1007s1c1
Sequence:CCGGGCCCTATACAACTTGTTTAATCTCGAGATTAAACAAGTTGTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013930.2-1006s1c1
Sequence:CCGGCGCCCTATACAACTTGTTTAACTCGAGTTAAACAAGTTGTATAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013930.2-2904s1c1
Sequence:CCGGCCGAAGCATCACACCTGTTAACTCGAGTTAACAGGTGTGATGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013930.3-2825s21c1
Sequence:CCGGCCAATATTGGAGCGGATTAAACTCGAGTTTAATCCGCTCCAATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013930.3-950s21c1
Sequence:CCGGCCCGTAGAATACGAGAAATATCTCGAGATATTTCTCGTATTCTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013930.3-1009s21c1
Sequence:CCGGGCCCTATACAACTTGTTTAATCTCGAGATTAAACAAGTTGTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013930.3-1807s21c1
Sequence:CCGGCATCGAAAGCAGGGTTAATATCTCGAGATATTAACCCTGCTTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013930.3-2906s21c1
Sequence:CCGGCCGAAGCATCACACCTGTTAACTCGAGTTAACAGGTGTGATGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013930
VALIDATED
AASS MISSION shRNA shRNA Plasmid DNA
aminoadipate-semialdehyde synthase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013930.2-501s1c1
Sequence:CCGGCGGCTCATTGATTATGAGAAACTCGAGTTTCTCATAATCAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013930.2-948s1c1
Sequence:CCGGCCCGTAGAATACGAGAAATATCTCGAGATATTTCTCGTATTCTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013930.2-1007s1c1
Sequence:CCGGGCCCTATACAACTTGTTTAATCTCGAGATTAAACAAGTTGTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013930.2-1006s1c1
Sequence:CCGGCGCCCTATACAACTTGTTTAACTCGAGTTAAACAAGTTGTATAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013930.2-2904s1c1
Sequence:CCGGCCGAAGCATCACACCTGTTAACTCGAGTTAACAGGTGTGATGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013930.3-2825s21c1
Sequence:CCGGCCAATATTGGAGCGGATTAAACTCGAGTTTAATCCGCTCCAATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013930.3-950s21c1
Sequence:CCGGCCCGTAGAATACGAGAAATATCTCGAGATATTTCTCGTATTCTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013930.3-1009s21c1
Sequence:CCGGGCCCTATACAACTTGTTTAATCTCGAGATTAAACAAGTTGTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013930.3-1807s21c1
Sequence:CCGGCATCGAAAGCAGGGTTAATATCTCGAGATATTAACCCTGCTTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013930.3-2906s21c1
Sequence:CCGGCCGAAGCATCACACCTGTTAACTCGAGTTAACAGGTGTGATGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013930
VALIDATED
AASS MISSION shRNA Lentiviral Transduction Particles
aminoadipate-semialdehyde synthase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013930.2-501s1c1
Sequence:CCGGCGGCTCATTGATTATGAGAAACTCGAGTTTCTCATAATCAATGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013930.2-948s1c1
Sequence:CCGGCCCGTAGAATACGAGAAATATCTCGAGATATTTCTCGTATTCTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013930.2-1007s1c1
Sequence:CCGGGCCCTATACAACTTGTTTAATCTCGAGATTAAACAAGTTGTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013930.2-1006s1c1
Sequence:CCGGCGCCCTATACAACTTGTTTAACTCGAGTTAAACAAGTTGTATAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013930.2-2904s1c1
Sequence:CCGGCCGAAGCATCACACCTGTTAACTCGAGTTAACAGGTGTGATGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013930.3-2825s21c1
Sequence:CCGGCCAATATTGGAGCGGATTAAACTCGAGTTTAATCCGCTCCAATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013930.3-950s21c1
Sequence:CCGGCCCGTAGAATACGAGAAATATCTCGAGATATTTCTCGTATTCTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013930.3-1009s21c1
Sequence:CCGGGCCCTATACAACTTGTTTAATCTCGAGATTAAACAAGTTGTATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013930.3-1807s21c1
Sequence:CCGGCATCGAAAGCAGGGTTAATATCTCGAGATATTAACCCTGCTTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013930.3-2906s21c1
Sequence:CCGGCCGAAGCATCACACCTGTTAACTCGAGTTAACAGGTGTGATGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks