EMAIL THIS PAGE TO A FRIEND

AATF

apoptosis antagonizing transcription factor

56 Gene Product Result for
Synonyms: CHE-1 CHE1 DED
UniProtKB ID: Q9NY61, A6NCJ6, B3KQ26, Q9P0A4, Q9UNX5
Gene ID:
Human(26574) Summary: The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008]
Mouse(56321) apoptosis antagonizing transcription factor
Rat(114512) apoptosis antagonizing transcription factor
Zebrafish(559477) apoptosis antagonizing transcription factor
chicken(417653) apoptosis antagonizing transcription factor
cow(786013) apoptosis antagonizing transcription factor
Horse(100057601) apoptosis antagonizing transcription factor
domestic cat(101087536) apoptosis antagonizing transcription factor
dog(480595) apoptosis antagonizing transcription factor
naked mole-rat(101705168) apoptosis antagonizing transcription factor
domestic guinea pig(100732839) apoptosis antagonizing transcription factor
sheep(101109984) apoptosis antagonizing transcription factor
Domestic Rabbit(100356226) apoptosis antagonizing transcription factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38957 Anti-AATF (AB1) antibody produced in rabbit IgG fraction of antiserum rat, canine, mouse, horse, rabbit, guinea pig, bovine, human
western blot pricing
AV38958 Anti-AATF (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, rat, rabbit, canine, mouse, guinea pig, horse, human
western blot pricing
HPA004940 Anti-AATF antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV31867 Anti-AATF antibody produced in rabbit affinity isolated antibody human, horse, yeast, rabbit, canine, rat, mouse
immunohistochemistry, western blot pricing
SAB3500251 Anti-AATF antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0026574M4 Monoclonal Anti-AATF antibody produced in mouse clone 3C7, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, western blot pricing
SAB1405021 Monoclonal Anti-AATF antibody produced in mouse clone 2H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0162 Rabbit anti-AATF/Che-1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gibbon, chimpanzee, primate, human, gorilla
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012138 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012138 Rosetta Predictions human pricing
NM_053720 Rosetta Predictions rat pricing
NM_019816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027096 predicted 1314
2 SASI_Hs01_00027097 predicted 1197
3 SASI_Hs01_00027098 predicted 1088
4 SASI_Hs01_00027099 predicted 1498
5 SASI_Hs01_00027100 predicted 1243
6 SASI_Hs01_00027101 predicted 1192
7 SASI_Hs01_00027102 predicted 1425
8 SASI_Hs01_00027103 predicted 395
9 SASI_Hs01_00027104 predicted 1147
10 SASI_Hs01_00027105 predicted 1865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044077 predicted 762
2 SASI_Rn01_00044078 predicted 757
3 SASI_Rn01_00044079 predicted 1265
4 SASI_Rn01_00044080 predicted 1083
5 SASI_Rn01_00044081 predicted 1032
6 SASI_Rn01_00044082 predicted 272
7 SASI_Rn01_00044083 predicted 772
8 SASI_Rn01_00044084 predicted 1518
9 SASI_Rn01_00044085 predicted 397
10 SASI_Rn02_00266485 predicted 657
11 SASI_Rn01_00044086 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095785 predicted 1094
2 SASI_Mm01_00095786 predicted 1086
3 SASI_Mm01_00095787 predicted 1513
4 SASI_Mm01_00095788 predicted 948
5 SASI_Mm02_00325094 predicted 757
6 SASI_Mm01_00095789 predicted 1265
7 SASI_Mm02_00325095 predicted 1227
8 SASI_Mm01_00095790 predicted 855
9 SASI_Mm01_00095791 predicted 1183
10 SASI_Mm01_00095793 predicted 752
11 SASI_Mm01_00095784 predicted 1386
12 SASI_Mm01_00095792 predicted 770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019816
VALIDATED
AATF MISSION shRNA Bacterial Glycerol Stock
apoptosis antagonizing transcription factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-917s21c1
Sequence:CCGGGTACCCAGACACGAGACATATCTCGAGATATGTCTCGTGTCTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-265s21c1
Sequence:CCGGATCTGGCAGTGAGTAGCATTACTCGAGTAATGCTACTCACTGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-1371s21c1
Sequence:CCGGGACTTGGATGAGGAGATATTTCTCGAGAAATATCTCCTCATCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-1639s21c1
Sequence:CCGGCGGAGTTGTTTCGATCTCTTTCTCGAGAAAGAGATCGAAACAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-1085s21c1
Sequence:CCGGTGCTGACTTCACCATCTATAGCTCGAGCTATAGATGGTGAAGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019816.1-567s1c1
Sequence:CCGGGAAGATGTTGAGGAGGACTTACTCGAGTAAGTCCTCCTCAACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019816.1-386s1c1
Sequence:CCGGGCCAAGTTCATCTGATAACGACTCGAGTCGTTATCAGATGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019816.1-1586s1c1
Sequence:CCGGCCTGAGTTTCATGGCACCTATCTCGAGATAGGTGCCATGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019816.1-1206s1c1
Sequence:CCGGGATCATATCATGATGGACAAACTCGAGTTTGTCCATCATGATATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019816.1-1639s1c1
Sequence:CCGGCGGAGTTGTTTCGATCTCTTTCTCGAGAAAGAGATCGAAACAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019816
VALIDATED
AATF MISSION shRNA shRNA Plasmid DNA
apoptosis antagonizing transcription factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-917s21c1
Sequence:CCGGGTACCCAGACACGAGACATATCTCGAGATATGTCTCGTGTCTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-265s21c1
Sequence:CCGGATCTGGCAGTGAGTAGCATTACTCGAGTAATGCTACTCACTGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-1371s21c1
Sequence:CCGGGACTTGGATGAGGAGATATTTCTCGAGAAATATCTCCTCATCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-1639s21c1
Sequence:CCGGCGGAGTTGTTTCGATCTCTTTCTCGAGAAAGAGATCGAAACAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-1085s21c1
Sequence:CCGGTGCTGACTTCACCATCTATAGCTCGAGCTATAGATGGTGAAGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019816.1-567s1c1
Sequence:CCGGGAAGATGTTGAGGAGGACTTACTCGAGTAAGTCCTCCTCAACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019816.1-386s1c1
Sequence:CCGGGCCAAGTTCATCTGATAACGACTCGAGTCGTTATCAGATGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019816.1-1586s1c1
Sequence:CCGGCCTGAGTTTCATGGCACCTATCTCGAGATAGGTGCCATGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019816.1-1206s1c1
Sequence:CCGGGATCATATCATGATGGACAAACTCGAGTTTGTCCATCATGATATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019816.1-1639s1c1
Sequence:CCGGCGGAGTTGTTTCGATCTCTTTCTCGAGAAAGAGATCGAAACAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019816
VALIDATED
AATF MISSION shRNA Lentiviral Transduction Particles
apoptosis antagonizing transcription factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-917s21c1
Sequence:CCGGGTACCCAGACACGAGACATATCTCGAGATATGTCTCGTGTCTGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-265s21c1
Sequence:CCGGATCTGGCAGTGAGTAGCATTACTCGAGTAATGCTACTCACTGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-1371s21c1
Sequence:CCGGGACTTGGATGAGGAGATATTTCTCGAGAAATATCTCCTCATCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-1639s21c1
Sequence:CCGGCGGAGTTGTTTCGATCTCTTTCTCGAGAAAGAGATCGAAACAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019816.1-1085s21c1
Sequence:CCGGTGCTGACTTCACCATCTATAGCTCGAGCTATAGATGGTGAAGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019816.1-567s1c1
Sequence:CCGGGAAGATGTTGAGGAGGACTTACTCGAGTAAGTCCTCCTCAACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019816.1-386s1c1
Sequence:CCGGGCCAAGTTCATCTGATAACGACTCGAGTCGTTATCAGATGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019816.1-1586s1c1
Sequence:CCGGCCTGAGTTTCATGGCACCTATCTCGAGATAGGTGCCATGAAACTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019816.1-1206s1c1
Sequence:CCGGGATCATATCATGATGGACAAACTCGAGTTTGTCCATCATGATATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019816.1-1639s1c1
Sequence:CCGGCGGAGTTGTTTCGATCTCTTTCTCGAGAAAGAGATCGAAACAACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012138
VALIDATED
AATF MISSION shRNA Bacterial Glycerol Stock
apoptosis antagonizing transcription factor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012138.3-1428s21c1
Sequence:CCGGTTGACTCAGATCGACCATATTCTCGAGAATATGGTCGATCTGAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012138.3-959s21c1
Sequence:CCGGGCTCTTGGAAGGAAGGATCAACTCGAGTTGATCCTTCCTTCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012138.3-1088s21c1
Sequence:CCGGCAAGGCACTTAAAGCATTGTTCTCGAGAACAATGCTTTAAGTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012138.3-1991s21c1
Sequence:CCGGATGGAGGAAACCAGTGACTTTCTCGAGAAAGTCACTGGTTTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012138.2-1276s1c1
Sequence:CCGGCACTTCAGAAATGGCACGATACTCGAGTATCGTGCCATTTCTGAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012138.2-1419s1c1
Sequence:CCGGCGCTCTGTCTATCGAGTTCTTCTCGAGAAGAACTCGATAGACAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012138.2-1016s1c1
Sequence:CCGGCAAGGCACTTAAAGCATTGTTCTCGAGAACAATGCTTTAAGTGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012138.2-887s1c1
Sequence:CCGGGCTCTTGGAAGGAAGGATCAACTCGAGTTGATCCTTCCTTCCAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012138.2-279s1c1
Sequence:CCGGGCCAGGGTGATTGACAGGTTTCTCGAGAAACCTGTCAATCACCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012138
VALIDATED
AATF MISSION shRNA shRNA Plasmid DNA
apoptosis antagonizing transcription factor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012138.3-1428s21c1
Sequence:CCGGTTGACTCAGATCGACCATATTCTCGAGAATATGGTCGATCTGAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012138.3-959s21c1
Sequence:CCGGGCTCTTGGAAGGAAGGATCAACTCGAGTTGATCCTTCCTTCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012138.3-1088s21c1
Sequence:CCGGCAAGGCACTTAAAGCATTGTTCTCGAGAACAATGCTTTAAGTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012138.3-1991s21c1
Sequence:CCGGATGGAGGAAACCAGTGACTTTCTCGAGAAAGTCACTGGTTTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012138.2-1276s1c1
Sequence:CCGGCACTTCAGAAATGGCACGATACTCGAGTATCGTGCCATTTCTGAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012138.2-1419s1c1
Sequence:CCGGCGCTCTGTCTATCGAGTTCTTCTCGAGAAGAACTCGATAGACAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012138.2-1016s1c1
Sequence:CCGGCAAGGCACTTAAAGCATTGTTCTCGAGAACAATGCTTTAAGTGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012138.2-887s1c1
Sequence:CCGGGCTCTTGGAAGGAAGGATCAACTCGAGTTGATCCTTCCTTCCAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012138.2-279s1c1
Sequence:CCGGGCCAGGGTGATTGACAGGTTTCTCGAGAAACCTGTCAATCACCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012138
VALIDATED
AATF MISSION shRNA Lentiviral Transduction Particles
apoptosis antagonizing transcription factor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_012138.3-1428s21c1
Sequence:CCGGTTGACTCAGATCGACCATATTCTCGAGAATATGGTCGATCTGAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012138.3-959s21c1
Sequence:CCGGGCTCTTGGAAGGAAGGATCAACTCGAGTTGATCCTTCCTTCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012138.3-1088s21c1
Sequence:CCGGCAAGGCACTTAAAGCATTGTTCTCGAGAACAATGCTTTAAGTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285201    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012138.3-1991s21c1
Sequence:CCGGATGGAGGAAACCAGTGACTTTCTCGAGAAAGTCACTGGTTTCCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012138.2-1276s1c1
Sequence:CCGGCACTTCAGAAATGGCACGATACTCGAGTATCGTGCCATTTCTGAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012138.2-1419s1c1
Sequence:CCGGCGCTCTGTCTATCGAGTTCTTCTCGAGAAGAACTCGATAGACAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012138.2-1016s1c1
Sequence:CCGGCAAGGCACTTAAAGCATTGTTCTCGAGAACAATGCTTTAAGTGCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_012138.2-887s1c1
Sequence:CCGGGCTCTTGGAAGGAAGGATCAACTCGAGTTGATCCTTCCTTCCAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012138.2-279s1c1
Sequence:CCGGGCCAGGGTGATTGACAGGTTTCTCGAGAAACCTGTCAATCACCCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks