EMAIL THIS PAGE TO A FRIEND

AATK-AS1

AATK antisense RNA 1

12 Gene Product Result for
Species: Human AATK-AS1(388428)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207389 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207389 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160222 predicted 616
2 SASI_Hs01_00160223 predicted 284
3 SASI_Hs01_00160224 predicted 344
4 SASI_Hs01_00160225 predicted 871
5 SASI_Hs01_00160226 predicted 856
6 SASI_Hs01_00160227 predicted 850
7 SASI_Hs01_00160228 predicted 1266
8 SASI_Hs01_00160229 predicted 719
9 SASI_Hs01_00160230 predicted 424
10 SASI_Hs01_00160231 predicted 1162
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207389
AATK-AS1 MISSION shRNA Bacterial Glycerol Stock
AATK antisense RNA 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207389.1-769s1c1
Sequence:CCGGCCAGATGAAGAAGATGGCCTTCTCGAGAAGGCCATCTTCTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207389.1-952s1c1
Sequence:CCGGCAAGGACAAGAGTGGCTTCATCTCGAGATGAAGCCACTCTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207389.1-868s1c1
Sequence:CCGGCCTCAAGTTCTTCAAGCACATCTCGAGATGTGCTTGAAGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207389.1-1410s1c1
Sequence:CCGGCCAAAGAAGAAGTAGCACCATCTCGAGATGGTGCTACTTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207389.1-613s1c1
Sequence:CCGGCTTCCAGAACTCTCGAAAGAACTCGAGTTCTTTCGAGAGTTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207389
AATK-AS1 MISSION shRNA shRNA Plasmid DNA
AATK antisense RNA 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207389.1-769s1c1
Sequence:CCGGCCAGATGAAGAAGATGGCCTTCTCGAGAAGGCCATCTTCTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207389.1-952s1c1
Sequence:CCGGCAAGGACAAGAGTGGCTTCATCTCGAGATGAAGCCACTCTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207389.1-868s1c1
Sequence:CCGGCCTCAAGTTCTTCAAGCACATCTCGAGATGTGCTTGAAGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207389.1-1410s1c1
Sequence:CCGGCCAAAGAAGAAGTAGCACCATCTCGAGATGGTGCTACTTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207389.1-613s1c1
Sequence:CCGGCTTCCAGAACTCTCGAAAGAACTCGAGTTCTTTCGAGAGTTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207389
AATK-AS1 MISSION shRNA Lentiviral Transduction Particles
AATK antisense RNA 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207389.1-769s1c1
Sequence:CCGGCCAGATGAAGAAGATGGCCTTCTCGAGAAGGCCATCTTCTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164833    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207389.1-952s1c1
Sequence:CCGGCAAGGACAAGAGTGGCTTCATCTCGAGATGAAGCCACTCTTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164588    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207389.1-868s1c1
Sequence:CCGGCCTCAAGTTCTTCAAGCACATCTCGAGATGTGCTTGAAGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164367    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207389.1-1410s1c1
Sequence:CCGGCCAAAGAAGAAGTAGCACCATCTCGAGATGGTGCTACTTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207389.1-613s1c1
Sequence:CCGGCTTCCAGAACTCTCGAAAGAACTCGAGTTCTTTCGAGAGTTCTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks