EMAIL THIS PAGE TO A FRIEND

AATK

apoptosis-associated tyrosine kinase

86 Gene Product Result for
Synonyms: AATYK AATYK1 LMR1 LMTK1 p35BP
UniProtKB ID: Q6ZMQ8, O75136, Q6ZN31, Q86X28
Gene ID:
Human(9625) Summary: The protein encoded by this gene contains a tyrosine kinase domain at the N-terminus and a proline-rich domain at the C-terminus. This gene is induced during apoptosis, and expression of this gene may be a necessary pre-requisite for the induction of growth arrest and/or apoptosis of myeloid precursor cells. This gene has been shown to produce neuronal differentiation in a neuroblastoma cell line. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Mouse(11302) apoptosis-associated tyrosine kinase
Rat(690853) apoptosis-associated tyrosine kinase
sheep(101101878) apoptosis-associated tyrosine kinase
domestic guinea pig(100734696) apoptosis-associated tyrosine kinase
naked mole-rat(101726585) apoptosis-associated tyrosine kinase
chicken(422076) apoptosis-associated tyrosine kinase
domestic cat(101095933) apoptosis-associated tyrosine kinase
dog(483358) apoptosis-associated tyrosine kinase
cow(511515) apoptosis-associated tyrosine kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007377 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007377 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007377 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_375495 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_375495 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_375495 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080395 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080395 Rosetta Predictions human pricing
XM_001714082 Rosetta Predictions human pricing
XM_927215 Rosetta Predictions human pricing
XM_001075880 Rosetta Predictions rat pricing
NM_007377 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314441 predicted 2885
2 SASI_Hs02_00314442 predicted 4460
3 SASI_Hs02_00314443 predicted 802
4 SASI_Hs02_00314444 predicted 2827
5 SASI_Hs02_00314445 predicted 661
6 SASI_Hs02_00314446 predicted 902
7 SASI_Hs02_00314447 predicted 4629
8 SASI_Hs02_00314448 predicted 4593
9 SASI_Hs02_00314449 predicted 2917
10 SASI_Hs02_00314450 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00394813 predicted 809
2 SASI_Hs02_00394814 predicted 587
3 SASI_Hs02_00394815 predicted 454
4 SASI_Hs02_00394816 predicted 782
5 SASI_Hs02_00394817 predicted 443
6 SASI_Hs02_00394818 predicted 592
7 SASI_Hs02_00394819 predicted 832
8 SASI_Hs02_00394820 predicted 643
9 SASI_Hs02_00394821 predicted 451
10 SASI_Hs02_00394822 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300295 predicted 1258
2 SASI_Hs01_00300296 predicted 1422
3 SASI_Hs01_00300297 predicted 1390
4 SASI_Hs01_00300298 predicted 919
5 SASI_Hs01_00300299 predicted 907
6 SASI_Hs01_00300300 predicted 808
7 SASI_Hs01_00300301 predicted 731
8 SASI_Hs01_00300302 predicted 874
9 SASI_Hs01_00300303 predicted 1380
10 SASI_Hs01_00300304 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351376 predicted 2358
2 SASI_Rn02_00351377 predicted 537
3 SASI_Rn02_00351378 predicted 3163
4 SASI_Rn02_00351379 predicted 934
5 SASI_Rn02_00351380 predicted 523
6 SASI_Rn02_00351381 predicted 3384
7 SASI_Rn02_00351382 predicted 2954
8 SASI_Rn02_00351383 predicted 267
9 SASI_Rn02_00351384 predicted 2952
10 SASI_Rn02_00351385 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007377 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198234 predicted 1450
2 SASI_Mm01_00198235 predicted 1272
3 SASI_Mm01_00198236 predicted 871
4 SASI_Mm01_00198237 predicted 4090
5 SASI_Mm01_00198238 predicted 1461
6 SASI_Mm01_00198240 predicted 2896
7 SASI_Mm01_00198241 predicted 1178
8 SASI_Mm01_00198242 predicted 1598
9 SASI_Mm01_00198243 predicted 3972
10 SASI_Mm02_00311471 predicted 461
11 SASI_Mm01_00198239 predicted 1775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007377
AATK MISSION shRNA Bacterial Glycerol Stock
apoptosis-associated tyrosine kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-1386s1c1
Sequence:CCGGCGGCCTCAACTTTGAATACAACTCGAGTTGTATTCAAAGTTGAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-1146s1c1
Sequence:CCGGGCTGTCCTACTTGTGTGCTAACTCGAGTTAGCACACAAGTAGGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-141s1c1
Sequence:CCGGCGGGTTCAAGGAGTTTGAGAACTCGAGTTCTCAAACTCCTTGAACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-2308s1c1
Sequence:CCGGCCCATTGTGGAACCCAAACTTCTCGAGAAGTTTGGGTTCCACAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-3625s1c1
Sequence:CCGGGCTGTGTCCTTCTTCGATGATCTCGAGATCATCGAAGAAGGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007377.3-875s21c1
Sequence:CCGGCAGTGAAGGTTGGTGATTATGCTCGAGCATAATCACCAACCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007377.3-2889s21c1
Sequence:CCGGCGTGGACAGTGGCTATGATACCTCGAGGTATCATAGCCACTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007377.3-3939s21c1
Sequence:CCGGGTTCGAATGGGATGGTGATTTCTCGAGAAATCACCATCCCATTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007377
AATK MISSION shRNA shRNA Plasmid DNA
apoptosis-associated tyrosine kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-1386s1c1
Sequence:CCGGCGGCCTCAACTTTGAATACAACTCGAGTTGTATTCAAAGTTGAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-1146s1c1
Sequence:CCGGGCTGTCCTACTTGTGTGCTAACTCGAGTTAGCACACAAGTAGGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-141s1c1
Sequence:CCGGCGGGTTCAAGGAGTTTGAGAACTCGAGTTCTCAAACTCCTTGAACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-2308s1c1
Sequence:CCGGCCCATTGTGGAACCCAAACTTCTCGAGAAGTTTGGGTTCCACAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-3625s1c1
Sequence:CCGGGCTGTGTCCTTCTTCGATGATCTCGAGATCATCGAAGAAGGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007377.3-875s21c1
Sequence:CCGGCAGTGAAGGTTGGTGATTATGCTCGAGCATAATCACCAACCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007377.3-2889s21c1
Sequence:CCGGCGTGGACAGTGGCTATGATACCTCGAGGTATCATAGCCACTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007377.3-3939s21c1
Sequence:CCGGGTTCGAATGGGATGGTGATTTCTCGAGAAATCACCATCCCATTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007377
AATK MISSION shRNA Lentiviral Transduction Particles
apoptosis-associated tyrosine kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-1386s1c1
Sequence:CCGGCGGCCTCAACTTTGAATACAACTCGAGTTGTATTCAAAGTTGAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-1146s1c1
Sequence:CCGGGCTGTCCTACTTGTGTGCTAACTCGAGTTAGCACACAAGTAGGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-141s1c1
Sequence:CCGGCGGGTTCAAGGAGTTTGAGAACTCGAGTTCTCAAACTCCTTGAACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-2308s1c1
Sequence:CCGGCCCATTGTGGAACCCAAACTTCTCGAGAAGTTTGGGTTCCACAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007377.1-3625s1c1
Sequence:CCGGGCTGTGTCCTTCTTCGATGATCTCGAGATCATCGAAGAAGGACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007377.3-875s21c1
Sequence:CCGGCAGTGAAGGTTGGTGATTATGCTCGAGCATAATCACCAACCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007377.3-2889s21c1
Sequence:CCGGCGTGGACAGTGGCTATGATACCTCGAGGTATCATAGCCACTGTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007377.3-3939s21c1
Sequence:CCGGGTTCGAATGGGATGGTGATTTCTCGAGAAATCACCATCCCATTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_375495
VALIDATED
AATK MISSION shRNA Bacterial Glycerol Stock
apoptosis-associated tyrosine kinase
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000021436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375495.1-2911s1c1
Sequence:CCGGAGTGGCCTCAACGAGAAGAATCTCGAGATTCTTCTCGTTGAGGCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375495.1-2001s1c1
Sequence:CCGGCAACGTGTCAGCCAACAACAACTCGAGTTGTTGTTGGCTGACACGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375495.1-685s1c1
Sequence:CCGGCTGCACCTTCATCGCAACAATCTCGAGATTGTTGCGATGAAGGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:XM_375495.1-2772s1c1
Sequence:CCGGTGGCTATGACACCGAGAACTACTCGAGTAGTTCTCGGTGTCATAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_375495
VALIDATED
AATK MISSION shRNA shRNA Plasmid DNA
apoptosis-associated tyrosine kinase
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000021436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375495.1-2911s1c1
Sequence:CCGGAGTGGCCTCAACGAGAAGAATCTCGAGATTCTTCTCGTTGAGGCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375495.1-2001s1c1
Sequence:CCGGCAACGTGTCAGCCAACAACAACTCGAGTTGTTGTTGGCTGACACGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375495.1-685s1c1
Sequence:CCGGCTGCACCTTCATCGCAACAATCTCGAGATTGTTGCGATGAAGGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:XM_375495.1-2772s1c1
Sequence:CCGGTGGCTATGACACCGAGAACTACTCGAGTAGTTCTCGGTGTCATAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_375495
VALIDATED
AATK MISSION shRNA Lentiviral Transduction Particles
apoptosis-associated tyrosine kinase
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000021436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375495.1-2911s1c1
Sequence:CCGGAGTGGCCTCAACGAGAAGAATCTCGAGATTCTTCTCGTTGAGGCCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375495.1-2001s1c1
Sequence:CCGGCAACGTGTCAGCCAACAACAACTCGAGTTGTTGTTGGCTGACACGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_375495.1-685s1c1
Sequence:CCGGCTGCACCTTCATCGCAACAATCTCGAGATTGTTGCGATGAAGGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:XM_375495.1-2772s1c1
Sequence:CCGGTGGCTATGACACCGAGAACTACTCGAGTAGTTCTCGGTGTCATAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080395
AATK MISSION shRNA Bacterial Glycerol Stock
apoptosis-associated tyrosine kinase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-1054s21c1
Sequence:GTACCGGTGACCATCTGGGAGCTCTTTGCTCGAGCAAAGAGCTCCCAGATGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080395.2-4592s21c1
Sequence:GTACCGGGTGTGCTCACAGGACACTTAACTCGAGTTAAGTGTCCTGTGAGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-4186s21c1
Sequence:CCGGGTGAGAGTAAAGAGGCTTGAGCTCGAGCTCAAGCCTCTTTACTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-256s21c1
Sequence:CCGGGTATCGGGTTCAAGGAGTTTGCTCGAGCAAACTCCTTGAACCCGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-805s21c1
Sequence:CCGGTGCACCTTCATCGCAACAATTCTCGAGAATTGTTGCGATGAAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-671s21c1
Sequence:CCGGCTACCTGCTGGTGATGGAGTTCTCGAGAACTCCATCACCAGCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080395.2-4745s21c1
Sequence:CCGGTCCGCTGCCCTTATCTCAAAGCTCGAGCTTTGAGATAAGGGCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080395
AATK MISSION shRNA shRNA Plasmid DNA
apoptosis-associated tyrosine kinase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-1054s21c1
Sequence:GTACCGGTGACCATCTGGGAGCTCTTTGCTCGAGCAAAGAGCTCCCAGATGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080395.2-4592s21c1
Sequence:GTACCGGGTGTGCTCACAGGACACTTAACTCGAGTTAAGTGTCCTGTGAGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-4186s21c1
Sequence:CCGGGTGAGAGTAAAGAGGCTTGAGCTCGAGCTCAAGCCTCTTTACTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-256s21c1
Sequence:CCGGGTATCGGGTTCAAGGAGTTTGCTCGAGCAAACTCCTTGAACCCGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-805s21c1
Sequence:CCGGTGCACCTTCATCGCAACAATTCTCGAGAATTGTTGCGATGAAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-671s21c1
Sequence:CCGGCTACCTGCTGGTGATGGAGTTCTCGAGAACTCCATCACCAGCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080395.2-4745s21c1
Sequence:CCGGTCCGCTGCCCTTATCTCAAAGCTCGAGCTTTGAGATAAGGGCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080395
AATK MISSION shRNA Lentiviral Transduction Particles
apoptosis-associated tyrosine kinase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-1054s21c1
Sequence:GTACCGGTGACCATCTGGGAGCTCTTTGCTCGAGCAAAGAGCTCCCAGATGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080395.2-4592s21c1
Sequence:GTACCGGGTGTGCTCACAGGACACTTAACTCGAGTTAAGTGTCCTGTGAGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-4186s21c1
Sequence:CCGGGTGAGAGTAAAGAGGCTTGAGCTCGAGCTCAAGCCTCTTTACTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-256s21c1
Sequence:CCGGGTATCGGGTTCAAGGAGTTTGCTCGAGCAAACTCCTTGAACCCGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-805s21c1
Sequence:CCGGTGCACCTTCATCGCAACAATTCTCGAGAATTGTTGCGATGAAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080395.2-671s21c1
Sequence:CCGGCTACCTGCTGGTGATGGAGTTCTCGAGAACTCCATCACCAGCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080395.2-4745s21c1
Sequence:CCGGTCCGCTGCCCTTATCTCAAAGCTCGAGCTTTGAGATAAGGGCAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks