EMAIL THIS PAGE TO A FRIEND

ABAT

4-aminobutyrate aminotransferase

108 Gene Product Result for
Synonyms: GABA-AT GABAT NPD009
UniProtKB ID: P80404, A8K386, Q16260, Q8N5W2, Q96BG2, Q99800
Gene ID:
Human(18) Summary: 4-aminobutyrate aminotransferase (ABAT) is responsible for catabolism of gamma-aminobutyric acid (GABA), an important, mostly inhibitory neurotransmitter in the central nervous system, into succinic semialdehyde. The active enzyme is a homodimer of 50-kD subunits complexed to pyridoxal-5-phosphate. The protein sequence is over 95% similar to the pig protein. GABA is estimated to be present in nearly one-third of human synapses. ABAT in liver and brain is controlled by 2 codominant alleles with a frequency in a Caucasian population of 0.56 and 0.44. The ABAT deficiency phenotype includes psychomotor retardation, hypotonia, hyperreflexia, lethargy, refractory seizures, and EEG abnormalities. Multiple alternatively spliced transcript variants encoding the same protein isoform have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(268860) 4-aminobutyrate aminotransferase
Rat(81632) 4-aminobutyrate aminotransferase
Zebrafish(378968) 4-aminobutyrate aminotransferase
cow(280969) 4-aminobutyrate aminotransferase
Horse(100051470) 4-aminobutyrate aminotransferase
domestic cat(101089064) 4-aminobutyrate aminotransferase
dog(479856) 4-aminobutyrate aminotransferase
chicken(416642) 4-aminobutyrate aminotransferase
naked mole-rat(101712584) 4-aminobutyrate aminotransferase
domestic guinea pig(100725419) 4-aminobutyrate aminotransferase
Goat(100861058) 4-aminobutyrate aminotransferase
sheep(101105462) 4-aminobutyrate aminotransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A230 4-Amino-5-hexynoic acid solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000663 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172961 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172961 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172961 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000663 Rosetta Predictions human pricing
NM_001127448 Rosetta Predictions human pricing
NM_020686 Rosetta Predictions human pricing
NM_031003 Rosetta Predictions rat pricing
NM_172961 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046198 predicted 1180
2 SASI_Hs01_00046200 predicted 1091
3 SASI_Hs01_00046201 predicted 1621
4 SASI_Hs01_00046202 predicted 2265
5 SASI_Hs01_00046203 predicted 1762
6 SASI_Hs01_00046204 predicted 2051
7 SASI_Hs01_00046205 predicted 2310
8 SASI_Hs01_00046206 predicted 2049
9 SASI_Hs01_00046207 predicted 1757
10 SASI_Hs02_00303026 predicted 1706
11 SASI_Hs01_00046199 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329544 predicted 501
2 SASI_Hs02_00329545 predicted 413
3 SASI_Hs02_00329546 predicted 939
4 SASI_Hs02_00329547 predicted 1594
5 SASI_Hs02_00329548 predicted 1076
6 SASI_Hs02_00329549 predicted 1366
7 SASI_Hs02_00329550 predicted 1624
8 SASI_Hs02_00329551 predicted 1373
9 SASI_Hs02_00329552 predicted 1085
10 SASI_Hs02_00329553 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161105 predicted 401
2 SASI_Hs01_00161107 predicted 325
3 SASI_Hs01_00161108 predicted 844
4 SASI_Hs01_00161109 predicted 1493
5 SASI_Hs01_00161110 predicted 984
6 SASI_Hs01_00161111 predicted 1279
7 SASI_Hs01_00161112 predicted 1533
8 SASI_Hs01_00161113 predicted 1273
9 SASI_Hs01_00161114 predicted 988
10 SASI_Hs02_00353683 predicted 929
11 SASI_Hs01_00161106 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031003 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116183 predicted 213
2 SASI_Rn01_00116184 predicted 914
3 SASI_Rn01_00116186 predicted 1006
4 SASI_Rn01_00116187 predicted 1443
5 SASI_Rn02_00264181 predicted 1148
6 SASI_Rn01_00116188 predicted 1435
7 SASI_Rn01_00116189 predicted 804
8 SASI_Rn01_00116190 predicted 919
9 SASI_Rn02_00264182 predicted 1019
10 SASI_Rn01_00116191 predicted 254
11 SASI_Rn01_00116185 predicted 657
12 SASI_Rn01_00116192 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134000 predicted 1678
2 SASI_Mm01_00134001 predicted 1532
3 SASI_Mm01_00134002 predicted 641
4 SASI_Mm01_00134003 predicted 1176
5 SASI_Mm01_00134004 predicted 1677
6 SASI_Mm01_00134005 predicted 1474
7 SASI_Mm01_00134006 predicted 370
8 SASI_Mm01_00134007 predicted 1405
9 SASI_Mm01_00134008 predicted 641
10 SASI_Mm01_00134009 predicted 1710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000663
VALIDATED
ABAT MISSION shRNA Bacterial Glycerol Stock
4-aminobutyrate aminotransferase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-2484s21c1
Sequence:CCGGGTTGTCAAATTGATTAGTTTGCTCGAGCAAACTAATCAATTTGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-1448s21c1
Sequence:CCGGCGCCTTAAAGACCATCTTCATCTCGAGATGAAGATGGTCTTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-2543s21c1
Sequence:CCGGTGCACAGTGAAGGGTGATTTGCTCGAGCAAATCACCCTTCACTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000663.4-2271s21c1
Sequence:CCGGCCCGATGATTCCATACGGAATCTCGAGATTCCGTATGGAATCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-2139s21c1
Sequence:CCGGCGGGAGGACCTGCTAAATAATCTCGAGATTATTTAGCAGGTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-1207s21c1
Sequence:CCGGGCAACCGAATGCTGGATCTTTCTCGAGAAAGATCCAGCATTCGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000663.2-608s1c1
Sequence:CCGGCGCCTTAAAGACCATCTTCATCTCGAGATGAAGATGGTCTTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000663.2-1431s1c1
Sequence:CCGGCCCGATGATTCCATACGGAATCTCGAGATTCCGTATGGAATCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000663.2-1299s1c1
Sequence:CCGGCGGGAGGACCTGCTAAATAATCTCGAGATTATTTAGCAGGTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000663.2-367s1c1
Sequence:CCGGGCAACCGAATGCTGGATCTTTCTCGAGAAAGATCCAGCATTCGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000663.2-782s1c1
Sequence:CCGGGCACTCTAAAGCCATTCACAACTCGAGTTGTGAATGGCTTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000663
VALIDATED
ABAT MISSION shRNA shRNA Plasmid DNA
4-aminobutyrate aminotransferase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-2484s21c1
Sequence:CCGGGTTGTCAAATTGATTAGTTTGCTCGAGCAAACTAATCAATTTGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-1448s21c1
Sequence:CCGGCGCCTTAAAGACCATCTTCATCTCGAGATGAAGATGGTCTTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-2543s21c1
Sequence:CCGGTGCACAGTGAAGGGTGATTTGCTCGAGCAAATCACCCTTCACTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000663.4-2271s21c1
Sequence:CCGGCCCGATGATTCCATACGGAATCTCGAGATTCCGTATGGAATCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-2139s21c1
Sequence:CCGGCGGGAGGACCTGCTAAATAATCTCGAGATTATTTAGCAGGTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-1207s21c1
Sequence:CCGGGCAACCGAATGCTGGATCTTTCTCGAGAAAGATCCAGCATTCGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000663.2-608s1c1
Sequence:CCGGCGCCTTAAAGACCATCTTCATCTCGAGATGAAGATGGTCTTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000663.2-1431s1c1
Sequence:CCGGCCCGATGATTCCATACGGAATCTCGAGATTCCGTATGGAATCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000663.2-1299s1c1
Sequence:CCGGCGGGAGGACCTGCTAAATAATCTCGAGATTATTTAGCAGGTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000663.2-367s1c1
Sequence:CCGGGCAACCGAATGCTGGATCTTTCTCGAGAAAGATCCAGCATTCGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000663.2-782s1c1
Sequence:CCGGGCACTCTAAAGCCATTCACAACTCGAGTTGTGAATGGCTTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000663
VALIDATED
ABAT MISSION shRNA Lentiviral Transduction Particles
4-aminobutyrate aminotransferase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-2484s21c1
Sequence:CCGGGTTGTCAAATTGATTAGTTTGCTCGAGCAAACTAATCAATTTGACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-1448s21c1
Sequence:CCGGCGCCTTAAAGACCATCTTCATCTCGAGATGAAGATGGTCTTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370053    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-2543s21c1
Sequence:CCGGTGCACAGTGAAGGGTGATTTGCTCGAGCAAATCACCCTTCACTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000663.4-2271s21c1
Sequence:CCGGCCCGATGATTCCATACGGAATCTCGAGATTCCGTATGGAATCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-2139s21c1
Sequence:CCGGCGGGAGGACCTGCTAAATAATCTCGAGATTATTTAGCAGGTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000663.4-1207s21c1
Sequence:CCGGGCAACCGAATGCTGGATCTTTCTCGAGAAAGATCCAGCATTCGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000663.2-608s1c1
Sequence:CCGGCGCCTTAAAGACCATCTTCATCTCGAGATGAAGATGGTCTTTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000663.2-1431s1c1
Sequence:CCGGCCCGATGATTCCATACGGAATCTCGAGATTCCGTATGGAATCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000663.2-1299s1c1
Sequence:CCGGCGGGAGGACCTGCTAAATAATCTCGAGATTATTTAGCAGGTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000663.2-367s1c1
Sequence:CCGGGCAACCGAATGCTGGATCTTTCTCGAGAAAGATCCAGCATTCGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000663.2-782s1c1
Sequence:CCGGGCACTCTAAAGCCATTCACAACTCGAGTTGTGAATGGCTTTAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172961
ABAT MISSION shRNA Bacterial Glycerol Stock
4-aminobutyrate aminotransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172961.2-2929s1c1
Sequence:CCGGCCTGGCTTTCATGCTTCCTTACTCGAGTAAGGAAGCATGAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172961.2-1479s1c1
Sequence:CCGGCGGAATAAACTCATCCTAATTCTCGAGAATTAGGATGAGTTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172961.2-287s1c1
Sequence:CCGGGCCTAGATCTAAGGAACTAATCTCGAGATTAGTTCCTTAGATCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172961.2-1181s1c1
Sequence:CCGGCGATGTGATGACGTTCAGCAACTCGAGTTGCTGAACGTCATCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172961.2-1610s1c1
Sequence:CCGGCGGCATCTTAGCAGACTTCAACTCGAGTTGAAGTCTGCTAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172961
ABAT MISSION shRNA shRNA Plasmid DNA
4-aminobutyrate aminotransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172961.2-2929s1c1
Sequence:CCGGCCTGGCTTTCATGCTTCCTTACTCGAGTAAGGAAGCATGAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172961.2-1479s1c1
Sequence:CCGGCGGAATAAACTCATCCTAATTCTCGAGAATTAGGATGAGTTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172961.2-287s1c1
Sequence:CCGGGCCTAGATCTAAGGAACTAATCTCGAGATTAGTTCCTTAGATCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172961.2-1181s1c1
Sequence:CCGGCGATGTGATGACGTTCAGCAACTCGAGTTGCTGAACGTCATCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172961.2-1610s1c1
Sequence:CCGGCGGCATCTTAGCAGACTTCAACTCGAGTTGAAGTCTGCTAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172961
ABAT MISSION shRNA Lentiviral Transduction Particles
4-aminobutyrate aminotransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172961.2-2929s1c1
Sequence:CCGGCCTGGCTTTCATGCTTCCTTACTCGAGTAAGGAAGCATGAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172961.2-1479s1c1
Sequence:CCGGCGGAATAAACTCATCCTAATTCTCGAGAATTAGGATGAGTTTATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172961.2-287s1c1
Sequence:CCGGGCCTAGATCTAAGGAACTAATCTCGAGATTAGTTCCTTAGATCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172961.2-1181s1c1
Sequence:CCGGCGATGTGATGACGTTCAGCAACTCGAGTTGCTGAACGTCATCACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172961.2-1610s1c1
Sequence:CCGGCGGCATCTTAGCAGACTTCAACTCGAGTTGAAGTCTGCTAAGATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks