EMAIL THIS PAGE TO A FRIEND

ABCA10

ATP-binding cassette, sub-family A (ABC1), member 10

64 Gene Product Result for
Synonyms: EST698739
Gene ID:
Human(10349) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. [provided by RefSeq, Jul 2008]
sheep(101108240) ATP-binding cassette, sub-family A (ABC1), member 10
domestic cat(101094062) ATP-binding cassette, sub-family A (ABC1), member 10
cow(504909) ATP-binding cassette, sub-family A (ABC1), member 10
Horse(100062390) ATP-binding cassette, sub-family A (ABC1), member 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080282 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080282 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242478 predicted 3337
2 SASI_Hs02_00362206 predicted 4791
3 SASI_Hs01_00242479 predicted 2228
4 SASI_Hs01_00242481 predicted 2495
5 SASI_Hs01_00242482 predicted 5541
6 SASI_Hs02_00362207 predicted 3205
7 SASI_Hs01_00242484 predicted 2137
8 SASI_Hs02_00362208 predicted 3162
9 SASI_Hs02_00362209 predicted 5459
10 SASI_Hs01_00242486 predicted 1182
11 SASI_Hs01_00242480 predicted 980
12 SASI_Hs01_00242483 predicted 2931
13 SASI_Hs01_00242485 predicted 5136
14 SASI_Hs01_00242487 predicted 5400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080282
ABCA10 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080282.3-1037s21c1
Sequence:CCGGGATATAGAATCCCAGTTATAACTCGAGTTATAACTGGGATTCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080282.3-3734s21c1
Sequence:CCGGTGAGCAGCATCAGCGATTATACTCGAGTATAATCGCTGATGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080282.3-2595s21c1
Sequence:CCGGGCATAAAGTAGACCGACTTATCTCGAGATAAGTCGGTCTACTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-3350s1c1
Sequence:CCGGCCAGCCTGTTAATCGTTAATACTCGAGTATTAACGATTAACAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-4161s1c1
Sequence:CCGGGCTCGACTTTATGAGAAACTTCTCGAGAAGTTTCTCATAAAGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-1672s1c1
Sequence:CCGGCCTTTATCTTTGGGATGGGTACTCGAGTACCCATCCCAAAGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-1250s1c1
Sequence:CCGGCTTTCATTTCTAAGGGAGAAACTCGAGTTTCTCCCTTAGAAATGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-3559s1c1
Sequence:CCGGCCTGTTCTTATGGGAATTGTTCTCGAGAACAATTCCCATAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080282
ABCA10 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080282.3-1037s21c1
Sequence:CCGGGATATAGAATCCCAGTTATAACTCGAGTTATAACTGGGATTCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080282.3-3734s21c1
Sequence:CCGGTGAGCAGCATCAGCGATTATACTCGAGTATAATCGCTGATGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080282.3-2595s21c1
Sequence:CCGGGCATAAAGTAGACCGACTTATCTCGAGATAAGTCGGTCTACTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-3350s1c1
Sequence:CCGGCCAGCCTGTTAATCGTTAATACTCGAGTATTAACGATTAACAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-4161s1c1
Sequence:CCGGGCTCGACTTTATGAGAAACTTCTCGAGAAGTTTCTCATAAAGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-1672s1c1
Sequence:CCGGCCTTTATCTTTGGGATGGGTACTCGAGTACCCATCCCAAAGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-1250s1c1
Sequence:CCGGCTTTCATTTCTAAGGGAGAAACTCGAGTTTCTCCCTTAGAAATGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-3559s1c1
Sequence:CCGGCCTGTTCTTATGGGAATTGTTCTCGAGAACAATTCCCATAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080282
ABCA10 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080282.3-1037s21c1
Sequence:CCGGGATATAGAATCCCAGTTATAACTCGAGTTATAACTGGGATTCTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080282.3-3734s21c1
Sequence:CCGGTGAGCAGCATCAGCGATTATACTCGAGTATAATCGCTGATGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080282.3-2595s21c1
Sequence:CCGGGCATAAAGTAGACCGACTTATCTCGAGATAAGTCGGTCTACTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-3350s1c1
Sequence:CCGGCCAGCCTGTTAATCGTTAATACTCGAGTATTAACGATTAACAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-4161s1c1
Sequence:CCGGGCTCGACTTTATGAGAAACTTCTCGAGAAGTTTCTCATAAAGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-1672s1c1
Sequence:CCGGCCTTTATCTTTGGGATGGGTACTCGAGTACCCATCCCAAAGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-1250s1c1
Sequence:CCGGCTTTCATTTCTAAGGGAGAAACTCGAGTTTCTCCCTTAGAAATGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080282.2-3559s1c1
Sequence:CCGGCCTGTTCTTATGGGAATTGTTCTCGAGAACAATTCCCATAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks