EMAIL THIS PAGE TO A FRIEND

ABCA11P

ATP-binding cassette, sub-family A (ABC1), member 11, pseudogene

Synonyms: ABCA11 EST1133530
Species: Human ABCA11P(79963)
UniProtKB ID: Q4W5N1, Q9H7T1
Gene ID:
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024903 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002451 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00376013 predicted 413
2 SASI_Hs02_00376014 predicted 1135
3 SASI_Hs02_00376015 predicted 429
4 SASI_Hs02_00376016 predicted 597
5 SASI_Hs02_00376017 predicted 1517
6 SASI_Hs02_00376018 predicted 1596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024903
ABCA11P MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 11, pseudogene
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024903.1-727s1c1
Sequence:CCGGGAGAACTCACTGTGTCCCAAACTCGAGTTTGGGACACAGTGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024903.1-356s1c1
Sequence:CCGGCATACCAATCCAGAAGAGCCTCTCGAGAGGCTCTTCTGGATTGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024903.1-339s1c1
Sequence:CCGGCACGAAGTAGAGGAACTCATACTCGAGTATGAGTTCCTCTACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024903.1-377s1c1
Sequence:CCGGGAAGAAGATGTTCAAGCTGAACTCGAGTTCAGCTTGAACATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024903.1-1244s1c1
Sequence:CCGGGCAGGAAAGATATTCCTCTTTCTCGAGAAAGAGGAATATCTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024903.1-395s1c1
Sequence:CCGGGAAAGAGTCCAAGCAGCAAATCTCGAGATTTGCTGCTTGGACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024903
ABCA11P MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 11, pseudogene
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024903.1-727s1c1
Sequence:CCGGGAGAACTCACTGTGTCCCAAACTCGAGTTTGGGACACAGTGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024903.1-356s1c1
Sequence:CCGGCATACCAATCCAGAAGAGCCTCTCGAGAGGCTCTTCTGGATTGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024903.1-339s1c1
Sequence:CCGGCACGAAGTAGAGGAACTCATACTCGAGTATGAGTTCCTCTACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024903.1-377s1c1
Sequence:CCGGGAAGAAGATGTTCAAGCTGAACTCGAGTTCAGCTTGAACATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024903.1-1244s1c1
Sequence:CCGGGCAGGAAAGATATTCCTCTTTCTCGAGAAAGAGGAATATCTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024903.1-395s1c1
Sequence:CCGGGAAAGAGTCCAAGCAGCAAATCTCGAGATTTGCTGCTTGGACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024903
ABCA11P MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 11, pseudogene
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024903.1-727s1c1
Sequence:CCGGGAGAACTCACTGTGTCCCAAACTCGAGTTTGGGACACAGTGAGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024903.1-356s1c1
Sequence:CCGGCATACCAATCCAGAAGAGCCTCTCGAGAGGCTCTTCTGGATTGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024903.1-339s1c1
Sequence:CCGGCACGAAGTAGAGGAACTCATACTCGAGTATGAGTTCCTCTACTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024903.1-377s1c1
Sequence:CCGGGAAGAAGATGTTCAAGCTGAACTCGAGTTCAGCTTGAACATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136292    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024903.1-1244s1c1
Sequence:CCGGGCAGGAAAGATATTCCTCTTTCTCGAGAAAGAGGAATATCTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024903.1-395s1c1
Sequence:CCGGGAAAGAGTCCAAGCAGCAAATCTCGAGATTTGCTGCTTGGACTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks