EMAIL THIS PAGE TO A FRIEND

ABCA12

ATP-binding cassette, sub-family A (ABC1), member 12

198 Gene Product Result for
Synonyms: ARCI4A ARCI4B ICR2B LI2
UniProtKB ID: Q86UK0, Q53QE2, Q53S55, Q8IZW6, Q96JT3, Q9Y4M5
Gene ID:
Human(26154) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(74591) ATP-binding cassette, sub-family A (ABC1), member 12
Rat(301482) ATP-binding cassette, subfamily A (ABC1), member 12
Zebrafish(558335) ATP-binding cassette, sub-family A (ABC1), member 12
dog(478900) ATP-binding cassette, sub-family A (ABC1), member 12
cow(523479) ATP-binding cassette, sub-family A (ABC1), member 12
Horse(100050461) ATP-binding cassette, sub-family A (ABC1), member 12
domestic cat(101081241) ATP-binding cassette, sub-family A (ABC1), member 12
chicken(424011) ATP-binding cassette, sub-family A (ABC1), member 12
sheep(101104887) ATP-binding cassette, sub-family A (ABC1), member 12
Domestic Rabbit(100341171) ATP-binding cassette, sub-family A (ABC1), member 12
domestic guinea pig(100732127) ATP-binding cassette, sub-family A (ABC1), member 12
naked mole-rat(101720431) ATP-binding cassette, sub-family A (ABC1), member 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175210 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175210 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175210 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015657 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015657 Rosetta Predictions human pricing
NM_173076 Rosetta Predictions human pricing
XM_001054709 Rosetta Predictions rat pricing
XM_237242 Rosetta Predictions rat pricing
XM_001002293 Rosetta Predictions mouse pricing
XM_001002305 Rosetta Predictions mouse pricing
XM_001002308 Rosetta Predictions mouse pricing
XM_987225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130791 predicted 1863
2 SASI_Hs01_00130792 predicted 2852
3 SASI_Hs01_00130793 predicted 5350
4 SASI_Hs01_00130795 predicted 1918
5 SASI_Hs01_00130796 predicted 2860
6 SASI_Hs02_00348276 predicted 982
7 SASI_Hs01_00130797 predicted 1882
8 SASI_Hs01_00130798 predicted 4799
9 SASI_Hs02_00348277 predicted 5168
10 SASI_Hs01_00130799 predicted 3520
11 SASI_Hs01_00130794 predicted 2391
12 SASI_Hs01_00130800 predicted 4227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183972 predicted 2881
2 SASI_Hs01_00183973 predicted 3862
3 SASI_Hs01_00183974 predicted 6358
4 SASI_Hs01_00183976 predicted 2931
5 SASI_Hs01_00183977 predicted 3869
6 SASI_Hs02_00368066 predicted 1991
7 SASI_Hs01_00183978 predicted 2890
8 SASI_Hs01_00183979 predicted 5814
9 SASI_Hs02_00368067 predicted 6186
10 SASI_Hs01_00183980 predicted 4534
11 SASI_Hs01_00183975 predicted 3402
12 SASI_Hs01_00183981 predicted 5233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054709 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276899 predicted 3548
2 SASI_Rn02_00276900 predicted 1770
3 SASI_Rn02_00276901 predicted 6403
4 SASI_Rn02_00276902 predicted 6120
5 SASI_Rn02_00276903 predicted 1175
6 SASI_Rn02_00276904 predicted 3918
7 SASI_Rn02_00276905 predicted 7738
8 SASI_Rn02_00276906 predicted 5336
9 SASI_Rn02_00276907 predicted 1118
10 SASI_Rn02_00276908 predicted 1393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390787 predicted 3546
2 SASI_Rn02_00390788 predicted 1762
3 SASI_Rn02_00390789 predicted 6401
4 SASI_Rn02_00390790 predicted 6111
5 SASI_Rn02_00390791 predicted 1177
6 SASI_Rn02_00390792 predicted 3915
7 SASI_Rn02_00390793 predicted 7737
8 SASI_Rn02_00390794 predicted 5333
9 SASI_Rn02_00390795 predicted 1117
10 SASI_Rn02_00390796 predicted 1394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247783 predicted 353
2 SASI_Mm01_00247784 predicted 339
3 SASI_Mm01_00247785 predicted 352
4 SASI_Mm01_00247786 predicted 335
5 SASI_Mm01_00247787 predicted 344
6 SASI_Mm01_00247788 predicted 636
7 SASI_Mm01_00247789 predicted 417
8 SASI_Mm01_00247790 predicted 588
9 SASI_Mm01_00247791 predicted 397
10 SASI_Mm01_00247792 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214274 predicted 2839
2 SASI_Mm01_00214275 predicted 2798
3 SASI_Mm01_00214276 predicted 2478
4 SASI_Mm01_00214277 predicted 2957
5 SASI_Mm01_00214278 predicted 2772
6 SASI_Mm01_00214279 predicted 2853
7 SASI_Mm01_00214280 predicted 2592
8 SASI_Mm01_00214281 predicted 2962
9 SASI_Mm01_00214282 predicted 2418
10 SASI_Mm01_00214283 predicted 2900
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241817 predicted 1420
2 SASI_Mm02_00355464 predicted 1779
3 SASI_Mm02_00355465 predicted 1891
4 SASI_Mm02_00355466 predicted 5739
5 SASI_Mm01_00241819 predicted 406
6 SASI_Mm02_00355467 predicted 1441
7 SASI_Mm01_00241821 predicted 1152
8 SASI_Mm01_00241825 predicted 1650
9 SASI_Mm02_00355468 predicted 2243
10 SASI_Mm02_00355469 predicted 956
11 SASI_Mm01_00241818 predicted 3476
12 SASI_Mm01_00241820 predicted 3982
13 SASI_Mm01_00241822 predicted 6434
14 SASI_Mm01_00241823 predicted 3365
15 SASI_Mm01_00241824 predicted 3998
16 SASI_Mm01_00241826 predicted 6387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_987225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00449291 predicted 1428
2 SASI_Mm02_00449292 predicted 412
3 SASI_Mm02_00449293 predicted 6699
4 SASI_Mm02_00449294 predicted 3982
5 SASI_Mm02_00449295 predicted 7211
6 SASI_Mm02_00449296 predicted 1152
7 SASI_Mm02_00449297 predicted 3365
8 SASI_Mm02_00449298 predicted 3993
9 SASI_Mm02_00449299 predicted 1656
10 SASI_Mm02_00449300 predicted 8067
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175210
ABCA12 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 12
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-2098s1c1
Sequence:CCGGCCGAGATAATTTCTCGTGTATCTCGAGATACACGAGAAATTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-2668s1c1
Sequence:CCGGCCCTTTACAAAGACATCATTACTCGAGTAATGATGTCTTTGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-814s1c1
Sequence:CCGGCACGCATCCTTGGTTTGGAAACTCGAGTTTCCAAACCAAGGATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-2074s1c1
Sequence:CCGGCCATTCCCATTCCAGACAATACTCGAGTATTGTCTGGAATGGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-631s1c1
Sequence:CCGGCGCTATTTAAAGAAAGCGAAACTCGAGTTTCGCTTTCTTTAAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175210.3-3538s21c1
Sequence:CCGGTATGGTCGCCTGGGTTGTATTCTCGAGAATACAACCCAGGCGACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175210.3-3398s21c1
Sequence:CCGGAGCATTGAGAGAGCAATTATTCTCGAGAATAATTGCTCTCTCAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175210
ABCA12 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 12
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-2098s1c1
Sequence:CCGGCCGAGATAATTTCTCGTGTATCTCGAGATACACGAGAAATTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-2668s1c1
Sequence:CCGGCCCTTTACAAAGACATCATTACTCGAGTAATGATGTCTTTGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-814s1c1
Sequence:CCGGCACGCATCCTTGGTTTGGAAACTCGAGTTTCCAAACCAAGGATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-2074s1c1
Sequence:CCGGCCATTCCCATTCCAGACAATACTCGAGTATTGTCTGGAATGGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-631s1c1
Sequence:CCGGCGCTATTTAAAGAAAGCGAAACTCGAGTTTCGCTTTCTTTAAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175210.3-3538s21c1
Sequence:CCGGTATGGTCGCCTGGGTTGTATTCTCGAGAATACAACCCAGGCGACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175210.3-3398s21c1
Sequence:CCGGAGCATTGAGAGAGCAATTATTCTCGAGAATAATTGCTCTCTCAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175210
ABCA12 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 12
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-2098s1c1
Sequence:CCGGCCGAGATAATTTCTCGTGTATCTCGAGATACACGAGAAATTATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-2668s1c1
Sequence:CCGGCCCTTTACAAAGACATCATTACTCGAGTAATGATGTCTTTGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-814s1c1
Sequence:CCGGCACGCATCCTTGGTTTGGAAACTCGAGTTTCCAAACCAAGGATGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-2074s1c1
Sequence:CCGGCCATTCCCATTCCAGACAATACTCGAGTATTGTCTGGAATGGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175210.2-631s1c1
Sequence:CCGGCGCTATTTAAAGAAAGCGAAACTCGAGTTTCGCTTTCTTTAAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175210.3-3538s21c1
Sequence:CCGGTATGGTCGCCTGGGTTGTATTCTCGAGAATACAACCCAGGCGACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175210.3-3398s21c1
Sequence:CCGGAGCATTGAGAGAGCAATTATTCTCGAGAATAATTGCTCTCTCAATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015657
ABCA12 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-3747s1c1
Sequence:CCGGCCGAAGTATATGGGATGTTATCTCGAGATAACATCCCATATACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-2531s1c1
Sequence:CCGGGCCATTTCTTTGCCTGGCTTACTCGAGTAAGCCAGGCAAAGAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-5967s1c1
Sequence:CCGGCCAACTTTATTGTCTCACAAACTCGAGTTTGTGAGACAATAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-5209s1c1
Sequence:CCGGGCCAGCTTTGTCACCTATGTTCTCGAGAACATAGGTGACAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-969s1c1
Sequence:CCGGCCCTGATAATAGAGCTGAGATCTCGAGATCTCAGCTCTATTATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015657.3-4808s21c1
Sequence:CCGGCTTACTCATCCCAGGTAATTTCTCGAGAAATTACCTGGGATGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015657.3-2662s21c1
Sequence:CCGGGACTACAGCTTCTCGGTTATTCTCGAGAATAACCGAGAAGCTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015657
ABCA12 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-3747s1c1
Sequence:CCGGCCGAAGTATATGGGATGTTATCTCGAGATAACATCCCATATACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-2531s1c1
Sequence:CCGGGCCATTTCTTTGCCTGGCTTACTCGAGTAAGCCAGGCAAAGAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-5967s1c1
Sequence:CCGGCCAACTTTATTGTCTCACAAACTCGAGTTTGTGAGACAATAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-5209s1c1
Sequence:CCGGGCCAGCTTTGTCACCTATGTTCTCGAGAACATAGGTGACAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-969s1c1
Sequence:CCGGCCCTGATAATAGAGCTGAGATCTCGAGATCTCAGCTCTATTATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015657.3-4808s21c1
Sequence:CCGGCTTACTCATCCCAGGTAATTTCTCGAGAAATTACCTGGGATGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015657.3-2662s21c1
Sequence:CCGGGACTACAGCTTCTCGGTTATTCTCGAGAATAACCGAGAAGCTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015657
ABCA12 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-3747s1c1
Sequence:CCGGCCGAAGTATATGGGATGTTATCTCGAGATAACATCCCATATACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-2531s1c1
Sequence:CCGGGCCATTTCTTTGCCTGGCTTACTCGAGTAAGCCAGGCAAAGAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-5967s1c1
Sequence:CCGGCCAACTTTATTGTCTCACAAACTCGAGTTTGTGAGACAATAAAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-5209s1c1
Sequence:CCGGGCCAGCTTTGTCACCTATGTTCTCGAGAACATAGGTGACAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015657.3-969s1c1
Sequence:CCGGCCCTGATAATAGAGCTGAGATCTCGAGATCTCAGCTCTATTATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015657.3-4808s21c1
Sequence:CCGGCTTACTCATCCCAGGTAATTTCTCGAGAAATTACCTGGGATGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015657.3-2662s21c1
Sequence:CCGGGACTACAGCTTCTCGGTTATTCTCGAGAATAACCGAGAAGCTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks