EMAIL THIS PAGE TO A FRIEND

ABCA13

ATP-binding cassette, sub-family A (ABC1), member 13

132 Gene Product Result for
UniProtKB ID: Q86UQ4, Q6ZTT7, Q86WI2, Q8N248
Gene ID:
Human(154664) Summary: In human, the ATP-binding cassette (ABC) family of transmembrane transporters has at least 48 genes and 7 gene subfamilies. This gene is a member of ABC gene subfamily A (ABCA). Genes within the ABCA family typically encode several thousand amino acids. Like other ABC transmembrane transporter proteins, this protein has 12 or more transmembrane alpha-helix domains that likely arrange to form a single central chamber with multiple substrate binding sites. It is also predicted to have two large extracellular domains and two nucleotide binding domains as is typical for ABCA proteins. Alternative splice variants have been described but their biological validity has not been demonstrated.[provided by RefSeq, Mar 2009]
Mouse(268379) ATP-binding cassette, sub-family A (ABC1), member 13
Rat(289797) ATP-binding cassette, subfamily A (ABC1), member 13
naked mole-rat(101701781) ATP-binding cassette, sub-family A (ABC1), member 13
domestic guinea pig(100735154) ATP-binding cassette, sub-family A (ABC1), member 13
chicken(420943) ATP-binding cassette, sub-family A (ABC1), member 13
cow(100300398) ATP-binding cassette, sub-family A (ABC1), member 13
Horse(100066185) ATP-binding cassette, sub-family A (ABC1), member 13
domestic cat(101082477) ATP-binding cassette, sub-family A (ABC1), member 13
dog(606966) ATP-binding cassette, sub-family A (ABC1), member 13
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152701 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178259 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178259 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178259 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079181 MISSION® esiRNA esiRNA human ABCA13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152701 Rosetta Predictions human pricing
NM_001106020 Rosetta Predictions rat pricing
NM_178259 Rosetta Predictions mouse pricing
XM_487151 Rosetta Predictions mouse pricing
XM_901244 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366593 predicted 10440
2 SASI_Hs01_00089770 predicted 4141
3 SASI_Hs02_00366594 predicted 11098
4 SASI_Hs02_00366595 predicted 3213
5 SASI_Hs02_00366596 predicted 8718
6 SASI_Hs01_00089773 predicted 10913
7 SASI_Hs01_00089774 predicted 8684
8 SASI_Hs01_00089776 predicted 14800
9 SASI_Hs01_00089777 predicted 8991
10 SASI_Hs01_00089778 predicted 8733
11 SASI_Hs01_00089771 predicted 12387
12 SASI_Hs01_00089772 predicted 4004
13 SASI_Hs01_00089775 predicted 15205
14 SASI_Hs01_00089779 predicted 12467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214832 predicted 9710
2 SASI_Rn02_00214833 predicted 5102
3 SASI_Rn02_00214834 predicted 4082
4 SASI_Rn02_00214835 predicted 8320
5 SASI_Rn02_00214836 predicted 441
6 SASI_Rn02_00214837 predicted 3593
7 SASI_Rn02_00214838 predicted 2108
8 SASI_Rn02_00214839 predicted 8891
9 SASI_Rn02_00214840 predicted 5686
10 SASI_Rn02_00214841 predicted 4197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348677 predicted 5393
2 SASI_Mm02_00348678 predicted 852
3 SASI_Mm02_00348679 predicted 7740
4 SASI_Mm02_00348680 predicted 1069
5 SASI_Mm02_00348681 predicted 3927
6 SASI_Mm02_00348682 predicted 5713
7 SASI_Mm02_00348683 predicted 4791
8 SASI_Mm02_00348684 predicted 10187
9 SASI_Mm02_00348685 predicted 8369
10 SASI_Mm02_00348686 predicted 9905
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_487151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00253903 predicted 10581
2 SASI_Mm01_00253904 predicted 13148
3 SASI_Mm01_00253905 predicted 11277
4 SASI_Mm01_00253906 predicted 10453
5 SASI_Mm01_00253907 predicted 11365
6 SASI_Mm01_00253908 predicted 11436
7 SASI_Mm01_00253909 predicted 11403
8 SASI_Mm01_00253910 predicted 10477
9 SASI_Mm01_00253911 predicted 10896
10 SASI_Mm01_00253912 predicted 10356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901244 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274655 predicted 460
2 SASI_Mm01_00274656 predicted 608
3 SASI_Mm01_00274657 predicted 781
4 SASI_Mm01_00274658 predicted 794
5 SASI_Mm01_00274659 predicted 393
6 SASI_Mm01_00274660 predicted 845
7 SASI_Mm01_00274661 predicted 518
8 SASI_Mm01_00274662 predicted 728
9 SASI_Mm01_00274663 predicted 430
10 SASI_Mm01_00274664 predicted 652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152701
ABCA13 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 13
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152701.3-4032s21c1
Sequence:CCGGTGTATCACATGATCGAGATTTCTCGAGAAATCTCGATCATGTGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152701.3-4140s21c1
Sequence:CCGGACGTATTCTAGACACGTTAAACTCGAGTTTAACGTGTCTAGAATACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-6081s1c1
Sequence:CCGGCGCATAATCTACTCTCTTTATCTCGAGATAAAGAGAGTAGATTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-7571s1c1
Sequence:CCGGGCCACATCAATGGACTCCATTCTCGAGAATGGAGTCCATTGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-167s1c1
Sequence:CCGGCCTCCCAGATACAGAGACATTCTCGAGAATGTCTCTGTATCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-9823s1c1
Sequence:CCGGGCCCAGAGTTAAGGAACTCTTCTCGAGAAGAGTTCCTTAACTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-5249s1c1
Sequence:CCGGGCTGTGATAGATGTGTACTATCTCGAGATAGTACACATCTATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152701
ABCA13 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 13
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152701.3-4032s21c1
Sequence:CCGGTGTATCACATGATCGAGATTTCTCGAGAAATCTCGATCATGTGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152701.3-4140s21c1
Sequence:CCGGACGTATTCTAGACACGTTAAACTCGAGTTTAACGTGTCTAGAATACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-6081s1c1
Sequence:CCGGCGCATAATCTACTCTCTTTATCTCGAGATAAAGAGAGTAGATTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-7571s1c1
Sequence:CCGGGCCACATCAATGGACTCCATTCTCGAGAATGGAGTCCATTGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-167s1c1
Sequence:CCGGCCTCCCAGATACAGAGACATTCTCGAGAATGTCTCTGTATCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-9823s1c1
Sequence:CCGGGCCCAGAGTTAAGGAACTCTTCTCGAGAAGAGTTCCTTAACTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-5249s1c1
Sequence:CCGGGCTGTGATAGATGTGTACTATCTCGAGATAGTACACATCTATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152701
ABCA13 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 13
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152701.3-4032s21c1
Sequence:CCGGTGTATCACATGATCGAGATTTCTCGAGAAATCTCGATCATGTGATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152701.3-4140s21c1
Sequence:CCGGACGTATTCTAGACACGTTAAACTCGAGTTTAACGTGTCTAGAATACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-6081s1c1
Sequence:CCGGCGCATAATCTACTCTCTTTATCTCGAGATAAAGAGAGTAGATTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-7571s1c1
Sequence:CCGGGCCACATCAATGGACTCCATTCTCGAGAATGGAGTCCATTGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-167s1c1
Sequence:CCGGCCTCCCAGATACAGAGACATTCTCGAGAATGTCTCTGTATCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-9823s1c1
Sequence:CCGGGCCCAGAGTTAAGGAACTCTTCTCGAGAAGAGTTCCTTAACTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152701.2-5249s1c1
Sequence:CCGGGCTGTGATAGATGTGTACTATCTCGAGATAGTACACATCTATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178259
ABCA13 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178259.3-4719s21c1
Sequence:CCGGCCATAGTGTCCTCGGAAATAACTCGAGTTATTTCCGAGGACACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178259.3-11991s21c1
Sequence:CCGGCCGAGAAGGTCGCACAATTATCTCGAGATAATTGTGCGACCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178259.3-5299s21c1
Sequence:CCGGCTTCGGAGAATCGTAGATAAACTCGAGTTTATCTACGATTCTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178259.3-15553s21c1
Sequence:CCGGATCAGTATGGTGTGATATAAACTCGAGTTTATATCACACCATACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178259.3-4269s21c1
Sequence:CCGGCTTACCCAGTCATAGTTATAACTCGAGTTATAACTATGACTGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178259
ABCA13 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178259.3-4719s21c1
Sequence:CCGGCCATAGTGTCCTCGGAAATAACTCGAGTTATTTCCGAGGACACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178259.3-11991s21c1
Sequence:CCGGCCGAGAAGGTCGCACAATTATCTCGAGATAATTGTGCGACCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178259.3-5299s21c1
Sequence:CCGGCTTCGGAGAATCGTAGATAAACTCGAGTTTATCTACGATTCTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178259.3-15553s21c1
Sequence:CCGGATCAGTATGGTGTGATATAAACTCGAGTTTATATCACACCATACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178259.3-4269s21c1
Sequence:CCGGCTTACCCAGTCATAGTTATAACTCGAGTTATAACTATGACTGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178259
ABCA13 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178259.3-4719s21c1
Sequence:CCGGCCATAGTGTCCTCGGAAATAACTCGAGTTATTTCCGAGGACACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178259.3-11991s21c1
Sequence:CCGGCCGAGAAGGTCGCACAATTATCTCGAGATAATTGTGCGACCTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178259.3-5299s21c1
Sequence:CCGGCTTCGGAGAATCGTAGATAAACTCGAGTTTATCTACGATTCTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178259.3-15553s21c1
Sequence:CCGGATCAGTATGGTGTGATATAAACTCGAGTTTATATCACACCATACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178259.3-4269s21c1
Sequence:CCGGCTTACCCAGTCATAGTTATAACTCGAGTTATAACTATGACTGGGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks