EMAIL THIS PAGE TO A FRIEND

ABCA1

ATP-binding cassette, sub-family A (ABC1), member 1

175 Gene Product Result for
Synonyms: ABC-1 ABC1 CERP HDLDT1 TGD
Gene ID:
Human(19) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. With cholesterol as its substrate, this protein functions as a cholesteral efflux pump in the cellular lipid removal pathway. Mutations in this gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
Mouse(11303) ATP-binding cassette, sub-family A (ABC1), member 1
Rat(313210) ATP-binding cassette, subfamily A (ABC1), member 1
Thale Cress(818768) ABC transporter A family member 1
cow(535379) ATP-binding cassette, sub-family A (ABC1), member 1
Horse(100054241) ATP-binding cassette, sub-family A (ABC1), member 1
domestic cat(101083885) ATP-binding cassette, sub-family A (ABC1), member 1
dog(481651) ATP-binding cassette, sub-family A (ABC1), member 1
chicken(373945) ATP-binding cassette, sub-family A (ABC1), member 1
naked mole-rat(101704546) ATP-binding cassette, sub-family A (ABC1), member 1
domestic guinea pig(100720792) ATP-binding cassette, sub-family A (ABC1), member 1
sheep(101119015) ATP-binding cassette, sub-family A (ABC1), member 1
Domestic Rabbit(100356765) ATP-binding cassette, sub-family A (ABC1), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
T2320 T0901317 ≥98% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005502 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU068891 MISSION® esiRNA esiRNA targeting mouse Abca1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005502 Rosetta Predictions human pricing
NM_178095 Rosetta Predictions rat pricing
NM_013454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129036 predicted 3287
2 SASI_Hs01_00129037 predicted 3195
3 SASI_Hs01_00129038 predicted 5539
4 SASI_Hs02_00339703 predicted 5950
5 SASI_Hs01_00129039 predicted 3941
6 SASI_Hs01_00129040 predicted 3923
7 SASI_Hs01_00129041 predicted 5010
8 SASI_Hs01_00129042 predicted 6597
9 SASI_Hs02_00339704 predicted 4199
10 SASI_Hs02_00339705 predicted 1000
11 SASI_Hs01_00129043 predicted 5193
12 SASI_Hs01_00129044 predicted 6563
13 SASI_Hs01_00129045 predicted 4957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030573 predicted 3824
2 SASI_Rn01_00030574 predicted 5940
3 SASI_Rn01_00030576 predicted 6065
4 SASI_Rn01_00030577 predicted 1163
5 SASI_Rn01_00030578 predicted 3796
6 SASI_Rn01_00030579 predicted 4917
7 SASI_Rn01_00030580 predicted 5889
8 SASI_Rn02_00269626 predicted 4461
9 SASI_Rn02_00269627 predicted 6157
10 SASI_Rn01_00030581 predicted 3434
11 SASI_Rn01_00030575 predicted 3960
12 SASI_Rn01_00030582 predicted 4692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075553 predicted 6607
2 SASI_Mm01_00075554 predicted 714
3 SASI_Mm01_00075555 predicted 5127
4 SASI_Mm02_00322046 predicted 5281
5 SASI_Mm01_00075556 predicted 6709
6 SASI_Mm01_00075557 predicted 871
7 SASI_Mm01_00075558 predicted 6446
8 SASI_Mm01_00075559 predicted 4023
9 SASI_Mm01_00075560 predicted 4535
10 SASI_Mm01_00075561 predicted 2619
11 SASI_Mm01_00075562 predicted 5385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005502
VALIDATED
ABCA1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005502.2-406s1c1
Sequence:CCGGGCCTCTATTTATCTTCCTGATCTCGAGATCAGGAAGATAAATAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005502.2-4949s1c1
Sequence:CCGGCCTCCGAGTCAAGAAGTTAATCTCGAGATTAACTTCTTGACTCGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005502.2-6411s1c1
Sequence:CCGGGCCTCGTGAAGTATGGAGAAACTCGAGTTTCTCCATACTTCACGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005502.2-584s1c1
Sequence:CCGGCCCGGAGTTGTTGGAAACTTTCTCGAGAAAGTTTCCAACAACTCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005502.2-343s1c1
Sequence:CCGGGCTGTGGAAGAACCTCACTTTCTCGAGAAAGTGAGGTTCTTCCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005502.2-343s21c1
Sequence:CCGGGCTGTGGAAGAACCTCACTTTCTCGAGAAAGTGAGGTTCTTCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005502.2-1405s21c1
Sequence:CCGGTAGTCCTCTTTCCCGCATTATCTCGAGATAATGCGGGAAAGAGGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005502.2-7350s21c1
Sequence:CCGGACCTATGTGAAACTCTATTATCTCGAGATAATAGAGTTTCACATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005502.2-6411s21c1
Sequence:CCGGGCCTCGTGAAGTATGGAGAAACTCGAGTTTCTCCATACTTCACGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005502.2-406s21c1
Sequence:CCGGGCCTCTATTTATCTTCCTGATCTCGAGATCAGGAAGATAAATAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005502
VALIDATED
ABCA1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005502.2-406s1c1
Sequence:CCGGGCCTCTATTTATCTTCCTGATCTCGAGATCAGGAAGATAAATAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005502.2-4949s1c1
Sequence:CCGGCCTCCGAGTCAAGAAGTTAATCTCGAGATTAACTTCTTGACTCGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005502.2-6411s1c1
Sequence:CCGGGCCTCGTGAAGTATGGAGAAACTCGAGTTTCTCCATACTTCACGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005502.2-584s1c1
Sequence:CCGGCCCGGAGTTGTTGGAAACTTTCTCGAGAAAGTTTCCAACAACTCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005502.2-343s1c1
Sequence:CCGGGCTGTGGAAGAACCTCACTTTCTCGAGAAAGTGAGGTTCTTCCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005502.2-343s21c1
Sequence:CCGGGCTGTGGAAGAACCTCACTTTCTCGAGAAAGTGAGGTTCTTCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005502.2-1405s21c1
Sequence:CCGGTAGTCCTCTTTCCCGCATTATCTCGAGATAATGCGGGAAAGAGGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005502.2-7350s21c1
Sequence:CCGGACCTATGTGAAACTCTATTATCTCGAGATAATAGAGTTTCACATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005502.2-6411s21c1
Sequence:CCGGGCCTCGTGAAGTATGGAGAAACTCGAGTTTCTCCATACTTCACGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005502.2-406s21c1
Sequence:CCGGGCCTCTATTTATCTTCCTGATCTCGAGATCAGGAAGATAAATAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005502
VALIDATED
ABCA1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005502.2-406s1c1
Sequence:CCGGGCCTCTATTTATCTTCCTGATCTCGAGATCAGGAAGATAAATAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005502.2-4949s1c1
Sequence:CCGGCCTCCGAGTCAAGAAGTTAATCTCGAGATTAACTTCTTGACTCGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005502.2-6411s1c1
Sequence:CCGGGCCTCGTGAAGTATGGAGAAACTCGAGTTTCTCCATACTTCACGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005502.2-584s1c1
Sequence:CCGGCCCGGAGTTGTTGGAAACTTTCTCGAGAAAGTTTCCAACAACTCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005502.2-343s1c1
Sequence:CCGGGCTGTGGAAGAACCTCACTTTCTCGAGAAAGTGAGGTTCTTCCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005502.2-343s21c1
Sequence:CCGGGCTGTGGAAGAACCTCACTTTCTCGAGAAAGTGAGGTTCTTCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_005502.2-1405s21c1
Sequence:CCGGTAGTCCTCTTTCCCGCATTATCTCGAGATAATGCGGGAAAGAGGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_005502.2-7350s21c1
Sequence:CCGGACCTATGTGAAACTCTATTATCTCGAGATAATAGAGTTTCACATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005502.2-6411s21c1
Sequence:CCGGGCCTCGTGAAGTATGGAGAAACTCGAGTTTCTCCATACTTCACGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005502.2-406s21c1
Sequence:CCGGGCCTCTATTTATCTTCCTGATCTCGAGATCAGGAAGATAAATAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013454
VALIDATED
ABCA1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013454.2-588s1c1
Sequence:CCGGCCCGGTGTTGTTGGAAACTTTCTCGAGAAAGTTTCCAACAACACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013454.2-589s1c1
Sequence:CCGGCCGGTGTTGTTGGAAACTTTACTCGAGTAAAGTTTCCAACAACACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013454.2-6415s1c1
Sequence:CCGGGCCTGGTAAAGTATGGAGAAACTCGAGTTTCTCCATACTTTACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013454.2-2191s1c1
Sequence:CCGGCCTGTTATGTTGATGACATTTCTCGAGAAATGTCATCAACATAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013454.2-9601s1c1
Sequence:CCGGCGCTAGATATACCTAGCATAACTCGAGTTATGCTAGGTATATCTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013454.3-477s21c1
Sequence:CCGGGAGTGCCACTTTCCGAATAAACTCGAGTTTATTCGGAAAGTGGCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013454.3-3556s21c1
Sequence:CCGGGGCAAGGCCGCACCATTATTTCTCGAGAAATAATGGTGCGGCCTTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013454.3-1412s21c1
Sequence:CCGGTAGTCCTCTTTCTCGAATTATCTCGAGATAATTCGAGAAAGAGGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013454.3-8526s21c1
Sequence:CCGGGCCTACTTGATAGCATCAATACTCGAGTATTGATGCTATCAAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013454
VALIDATED
ABCA1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013454.2-588s1c1
Sequence:CCGGCCCGGTGTTGTTGGAAACTTTCTCGAGAAAGTTTCCAACAACACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013454.2-589s1c1
Sequence:CCGGCCGGTGTTGTTGGAAACTTTACTCGAGTAAAGTTTCCAACAACACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013454.2-6415s1c1
Sequence:CCGGGCCTGGTAAAGTATGGAGAAACTCGAGTTTCTCCATACTTTACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013454.2-2191s1c1
Sequence:CCGGCCTGTTATGTTGATGACATTTCTCGAGAAATGTCATCAACATAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013454.2-9601s1c1
Sequence:CCGGCGCTAGATATACCTAGCATAACTCGAGTTATGCTAGGTATATCTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013454.3-477s21c1
Sequence:CCGGGAGTGCCACTTTCCGAATAAACTCGAGTTTATTCGGAAAGTGGCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013454.3-3556s21c1
Sequence:CCGGGGCAAGGCCGCACCATTATTTCTCGAGAAATAATGGTGCGGCCTTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013454.3-1412s21c1
Sequence:CCGGTAGTCCTCTTTCTCGAATTATCTCGAGATAATTCGAGAAAGAGGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013454.3-8526s21c1
Sequence:CCGGGCCTACTTGATAGCATCAATACTCGAGTATTGATGCTATCAAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013454
VALIDATED
ABCA1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013454.2-588s1c1
Sequence:CCGGCCCGGTGTTGTTGGAAACTTTCTCGAGAAAGTTTCCAACAACACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013454.2-589s1c1
Sequence:CCGGCCGGTGTTGTTGGAAACTTTACTCGAGTAAAGTTTCCAACAACACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013454.2-6415s1c1
Sequence:CCGGGCCTGGTAAAGTATGGAGAAACTCGAGTTTCTCCATACTTTACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013454.2-2191s1c1
Sequence:CCGGCCTGTTATGTTGATGACATTTCTCGAGAAATGTCATCAACATAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013454.2-9601s1c1
Sequence:CCGGCGCTAGATATACCTAGCATAACTCGAGTTATGCTAGGTATATCTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013454.3-477s21c1
Sequence:CCGGGAGTGCCACTTTCCGAATAAACTCGAGTTTATTCGGAAAGTGGCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013454.3-3556s21c1
Sequence:CCGGGGCAAGGCCGCACCATTATTTCTCGAGAAATAATGGTGCGGCCTTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013454.3-1412s21c1
Sequence:CCGGTAGTCCTCTTTCTCGAATTATCTCGAGATAATTCGAGAAAGAGGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013454.3-8526s21c1
Sequence:CCGGGCCTACTTGATAGCATCAATACTCGAGTATTGATGCTATCAAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)