EMAIL THIS PAGE TO A FRIEND

ABCA2

ATP-binding cassette, sub-family A (ABC1), member 2

Synonyms: ABC2
UniProtKB ID: Q9BZC7, A6NED5, Q5SPY5, Q5W9G5, Q76MW7, Q9HC28
Gene ID:
Human(20) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is highly expressed in brain tissue and may play a role in macrophage lipid metabolism and neural development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11305) ATP-binding cassette, sub-family A (ABC1), member 2
Rat(79248) ATP-binding cassette, subfamily A (ABC1), member 2
Zebrafish(100124617) ATP-binding cassette, sub-family A (ABC1), member 2
cow(100299651) ATP-binding cassette, sub-family A (ABC1), member 2
Horse(100067889) ATP-binding cassette, sub-family A (ABC1), member 2
domestic cat(101100095) ATP-binding cassette, sub-family A (ABC1), member 2
dog(480669) ATP-binding cassette, sub-family A (ABC1), member 2
chicken(426955) ATP-binding cassette, sub-family A (ABC1), member 2
Thale Cress(823927) ABC transporter A family member 2
domestic guinea pig(100731855) ATP-binding cassette, sub-family A (ABC1), member 2
naked mole-rat(101697102) ATP-binding cassette, sub-family A (ABC1), member 2
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001606 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007379 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007379 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007379 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157261 MISSION® esiRNA esiRNA human ABCA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001606 Rosetta Predictions human pricing
NM_212533 Rosetta Predictions human pricing
NM_024396 Rosetta Predictions rat pricing
NM_007379 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057343 predicted 2088
2 SASI_Hs01_00057344 predicted 2459
3 SASI_Hs01_00057345 predicted 6163
4 SASI_Hs01_00057346 predicted 1625
5 SASI_Hs01_00057347 predicted 5711
6 SASI_Hs01_00057348 predicted 6838
7 SASI_Hs01_00057349 predicted 6283
8 SASI_Hs01_00057350 predicted 6315
9 SASI_Hs01_00057351 predicted 3402
10 SASI_Hs01_00057352 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154451 predicted 2074
2 SASI_Hs01_00154452 predicted 2453
3 SASI_Hs01_00154453 predicted 6154
4 SASI_Hs01_00154454 predicted 1617
5 SASI_Hs01_00154455 predicted 5696
6 SASI_Hs01_00154456 predicted 6825
7 SASI_Hs01_00154457 predicted 6270
8 SASI_Hs01_00154458 predicted 6314
9 SASI_Hs01_00154459 predicted 3393
10 SASI_Hs01_00154460 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263991 predicted 2245
2 SASI_Rn02_00263992 predicted 5981
3 SASI_Rn01_00048964 predicted 5937
4 SASI_Rn02_00263993 predicted 711
5 SASI_Rn02_00263994 predicted 7132
6 SASI_Rn01_00048968 predicted 1642
7 SASI_Rn01_00048969 predicted 1866
8 SASI_Rn01_00048970 predicted 2449
9 SASI_Rn01_00048971 predicted 6759
10 SASI_Rn02_00263995 predicted 3480
11 SASI_Rn01_00048965 predicted 2651
12 SASI_Rn01_00048966 predicted 1542
13 SASI_Rn01_00048967 predicted 4781
14 SASI_Rn01_00048972 predicted 3565
15 SASI_Rn01_00048973 predicted 7351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007379 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136730 predicted 4599
2 SASI_Mm01_00136731 predicted 2203
3 SASI_Mm01_00136732 predicted 1220
4 SASI_Mm01_00136733 predicted 2674
5 SASI_Mm02_00311475 predicted 4808
6 SASI_Mm01_00136735 predicted 1634
7 SASI_Mm01_00136736 predicted 5736
8 SASI_Mm01_00136737 predicted 1890
9 SASI_Mm01_00136738 predicted 7177
10 SASI_Mm01_00136739 predicted 1634
11 SASI_Mm01_00136734 predicted 7070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001606
ABCA2 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001606.4-2736s21c1
Sequence:CCGGCTAAGTACTTCGCGCTGTATGCTCGAGCATACAGCGCGAAGTACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001606.4-6051s21c1
Sequence:CCGGACGAGTACTACGCCAAGATTGCTCGAGCAATCTTGGCGTAGTACTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-2665s1c1
Sequence:CCGGGCATGATAAGATCACGGCCTTCTCGAGAAGGCCGTGATCTTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-5863s1c1
Sequence:CCGGCGTGTTCCTCATTGTCATCAACTCGAGTTGATGACAATGAGGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-7211s1c1
Sequence:CCGGGACAATGTGTTCGTGAACTTTCTCGAGAAAGTTCACGAACACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-6286s1c1
Sequence:CCGGCGACAATGACATGGTCAAGATCTCGAGATCTTGACCATGTCATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-1903s1c1
Sequence:CCGGCGAGGAGAGCATTGTCAACTACTCGAGTAGTTGACAATGCTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001606
ABCA2 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001606.4-2736s21c1
Sequence:CCGGCTAAGTACTTCGCGCTGTATGCTCGAGCATACAGCGCGAAGTACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001606.4-6051s21c1
Sequence:CCGGACGAGTACTACGCCAAGATTGCTCGAGCAATCTTGGCGTAGTACTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-2665s1c1
Sequence:CCGGGCATGATAAGATCACGGCCTTCTCGAGAAGGCCGTGATCTTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-5863s1c1
Sequence:CCGGCGTGTTCCTCATTGTCATCAACTCGAGTTGATGACAATGAGGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-7211s1c1
Sequence:CCGGGACAATGTGTTCGTGAACTTTCTCGAGAAAGTTCACGAACACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-6286s1c1
Sequence:CCGGCGACAATGACATGGTCAAGATCTCGAGATCTTGACCATGTCATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-1903s1c1
Sequence:CCGGCGAGGAGAGCATTGTCAACTACTCGAGTAGTTGACAATGCTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001606
ABCA2 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001606.4-2736s21c1
Sequence:CCGGCTAAGTACTTCGCGCTGTATGCTCGAGCATACAGCGCGAAGTACTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001606.4-6051s21c1
Sequence:CCGGACGAGTACTACGCCAAGATTGCTCGAGCAATCTTGGCGTAGTACTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-2665s1c1
Sequence:CCGGGCATGATAAGATCACGGCCTTCTCGAGAAGGCCGTGATCTTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-5863s1c1
Sequence:CCGGCGTGTTCCTCATTGTCATCAACTCGAGTTGATGACAATGAGGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-7211s1c1
Sequence:CCGGGACAATGTGTTCGTGAACTTTCTCGAGAAAGTTCACGAACACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-6286s1c1
Sequence:CCGGCGACAATGACATGGTCAAGATCTCGAGATCTTGACCATGTCATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001606.3-1903s1c1
Sequence:CCGGCGAGGAGAGCATTGTCAACTACTCGAGTAGTTGACAATGCTCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007379
ABCA2 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007379.1-7392s1c1
Sequence:CCGGGAAAGGCAGGTTCAGGACCAACTCGAGTTGGTCCTGAACCTGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007379.1-1999s1c1
Sequence:CCGGCGCGCCATCATCAACACATTTCTCGAGAAATGTGTTGATGATGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007379.1-6891s1c1
Sequence:CCGGGCGGTTCTTCAACAGGAACTTCTCGAGAAGTTCCTGTTGAAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007379.1-1408s1c1
Sequence:CCGGCGCGTTATCCTCAAGGCAAATCTCGAGATTTGCCTTGAGGATAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007379.1-4501s1c1
Sequence:CCGGCGTGGCAACTTTATCCCTTATCTCGAGATAAGGGATAAAGTTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007379
ABCA2 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007379.1-7392s1c1
Sequence:CCGGGAAAGGCAGGTTCAGGACCAACTCGAGTTGGTCCTGAACCTGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007379.1-1999s1c1
Sequence:CCGGCGCGCCATCATCAACACATTTCTCGAGAAATGTGTTGATGATGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007379.1-6891s1c1
Sequence:CCGGGCGGTTCTTCAACAGGAACTTCTCGAGAAGTTCCTGTTGAAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007379.1-1408s1c1
Sequence:CCGGCGCGTTATCCTCAAGGCAAATCTCGAGATTTGCCTTGAGGATAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007379.1-4501s1c1
Sequence:CCGGCGTGGCAACTTTATCCCTTATCTCGAGATAAGGGATAAAGTTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007379
ABCA2 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007379.1-7392s1c1
Sequence:CCGGGAAAGGCAGGTTCAGGACCAACTCGAGTTGGTCCTGAACCTGCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007379.1-1999s1c1
Sequence:CCGGCGCGCCATCATCAACACATTTCTCGAGAAATGTGTTGATGATGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007379.1-6891s1c1
Sequence:CCGGGCGGTTCTTCAACAGGAACTTCTCGAGAAGTTCCTGTTGAAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007379.1-1408s1c1
Sequence:CCGGCGCGTTATCCTCAAGGCAAATCTCGAGATTTGCCTTGAGGATAACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007379.1-4501s1c1
Sequence:CCGGCGTGGCAACTTTATCCCTTATCTCGAGATAAGGGATAAAGTTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks