EMAIL THIS PAGE TO A FRIEND

ABCA3

ATP-binding cassette, sub-family A (ABC1), member 3

Synonyms: ABC-C ABC3 EST111653 LBM180 SMDP3
UniProtKB ID: Q99758, B2RU09, Q54A95, Q92473
Gene ID:
Human(21) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
Mouse(27410) ATP-binding cassette, sub-family A (ABC1), member 3
Rat(302973) ATP-binding cassette, subfamily A (ABC1), member 3
naked mole-rat(101704653) ATP-binding cassette, sub-family A (ABC1), member 3
domestic guinea pig(100734020) ATP-binding cassette, sub-family A (ABC1), member 3
sheep(101115674) ATP-binding cassette, sub-family A (ABC1), member 3
Domestic Rabbit(100345135) ATP-binding cassette, sub-family A (ABC1), member 3
chicken(416386) ATP-binding cassette, sub-family A (ABC1), member 3
domestic cat(101081433) ATP-binding cassette, sub-family A (ABC1), member 3
cow(505787) ATP-binding cassette, sub-family A (ABC1), member 3
dog(479879) ATP-binding cassette, sub-family A (ABC1), member 3
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA007884 Anti-ABCA3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001089 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001089 Rosetta Predictions human pricing
XM_001054547 Rosetta Predictions rat pricing
XM_001054596 Rosetta Predictions rat pricing
XM_001054650 Rosetta Predictions rat pricing
XM_001054721 Rosetta Predictions rat pricing
XM_220219 Rosetta Predictions rat pricing
NM_001039581 Rosetta Predictions mouse pricing
NM_013855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125344 predicted 1046
2 SASI_Hs01_00125345 predicted 2966
3 SASI_Hs01_00125346 predicted 1058
4 SASI_Hs01_00125347 predicted 1189
5 SASI_Hs01_00125349 predicted 3121
6 SASI_Hs01_00125350 predicted 2974
7 SASI_Hs01_00125351 predicted 5510
8 SASI_Hs01_00125352 predicted 832
9 SASI_Hs02_00318017 predicted 1784
10 SASI_Hs01_00125353 predicted 4952
11 SASI_Hs01_00125348 predicted 5750
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276213 predicted 2558
2 SASI_Rn02_00276214 predicted 4950
3 SASI_Rn02_00276215 predicted 5317
4 SASI_Rn02_00276216 predicted 670
5 SASI_Rn02_00276217 predicted 2382
6 SASI_Rn02_00276218 predicted 3838
7 SASI_Rn02_00276219 predicted 853
8 SASI_Rn02_00276220 predicted 1521
9 SASI_Rn02_00276221 predicted 643
10 SASI_Rn02_00276222 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276390 predicted 2558
2 SASI_Rn02_00276391 predicted 4170
3 SASI_Rn02_00276392 predicted 4672
4 SASI_Rn02_00276393 predicted 672
5 SASI_Rn02_00276394 predicted 2380
6 SASI_Rn02_00276395 predicted 3080
7 SASI_Rn02_00276396 predicted 853
8 SASI_Rn02_00276397 predicted 1512
9 SASI_Rn02_00276398 predicted 647
10 SASI_Rn02_00276399 predicted 1697
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276627 predicted 2497
2 SASI_Rn02_00276628 predicted 4875
3 SASI_Rn02_00276629 predicted 5368
4 SASI_Rn02_00276630 predicted 610
5 SASI_Rn02_00276631 predicted 2315
6 SASI_Rn02_00276632 predicted 3775
7 SASI_Rn02_00276633 predicted 1453
8 SASI_Rn02_00276634 predicted 583
9 SASI_Rn02_00276635 predicted 1639
10 SASI_Rn02_00276636 predicted 3670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276949 predicted 2570
2 SASI_Rn02_00276950 predicted 4951
3 SASI_Rn02_00276951 predicted 5445
4 SASI_Rn02_00276952 predicted 679
5 SASI_Rn02_00276953 predicted 2386
6 SASI_Rn02_00276954 predicted 3849
7 SASI_Rn02_00276955 predicted 1528
8 SASI_Rn02_00276956 predicted 653
9 SASI_Rn02_00276957 predicted 1710
10 SASI_Rn02_00276958 predicted 3741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379135 predicted 2049
2 SASI_Rn02_00379136 predicted 4430
3 SASI_Rn02_00379137 predicted 4921
4 SASI_Rn02_00379138 predicted 216
5 SASI_Rn02_00379139 predicted 1872
6 SASI_Rn02_00379140 predicted 3336
7 SASI_Rn02_00379141 predicted 402
8 SASI_Rn02_00379142 predicted 1191
9 SASI_Rn02_00379143 predicted 3219
10 SASI_Rn02_00379144 predicted 4235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039581 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118885 predicted 2508
2 SASI_Mm01_00118886 predicted 1919
3 SASI_Mm01_00118889 predicted 3293
4 SASI_Mm01_00118890 predicted 4144
5 SASI_Mm01_00118891 predicted 1105
6 SASI_Mm01_00118892 predicted 3212
7 SASI_Mm02_00290165 predicted 5269
8 SASI_Mm01_00118893 predicted 3002
9 SASI_Mm02_00290166 predicted 583
10 SASI_Mm01_00118894 predicted 3763
11 SASI_Mm01_00118887 predicted 5382
12 SASI_Mm01_00118888 predicted 3643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084755 predicted 2574
2 SASI_Mm01_00084756 predicted 1998
3 SASI_Mm01_00084759 predicted 3366
4 SASI_Mm01_00084760 predicted 4216
5 SASI_Mm01_00084761 predicted 1172
6 SASI_Mm01_00084762 predicted 3280
7 SASI_Mm02_00322873 predicted 5339
8 SASI_Mm01_00084763 predicted 3077
9 SASI_Mm02_00322874 predicted 663
10 SASI_Mm01_00084764 predicted 3833
11 SASI_Mm01_00084757 predicted 5458
12 SASI_Mm01_00084758 predicted 3708
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001089
VALIDATED
ABCA3 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001089.1-687s1c1
Sequence:CCGGGCTTGAAGATTCAGTCGGAAACTCGAGTTTCCGACTGAATCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001089.1-1024s1c1
Sequence:CCGGGTTCAGTTACACACGGAGAAACTCGAGTTTCTCCGTGTGTAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001089.1-2327s1c1
Sequence:CCGGGCATACATCAGCGGGTATGAACTCGAGTTCATACCCGCTGATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001089.1-4687s1c1
Sequence:CCGGGCTCCACACACCTCTGATTATCTCGAGATAATCAGAGGTGTGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001089.2-1177s21c1
Sequence:CCGGGTTCAGTTACACACGGAGAAACTCGAGTTTCTCCGTGTGTAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001089.2-2250s21c1
Sequence:CCGGCACTCAGAAACGAGTACTTTGCTCGAGCAAAGTACTCGTTTCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001089.2-5887s21c1
Sequence:CCGGCATCCTCTCTCTCCAAGTTTACTCGAGTAAACTTGGAGAGAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089.2-840s21c1
Sequence:CCGGGCTTGAAGATTCAGTCGGAAACTCGAGTTTCCGACTGAATCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001089.2-4840s21c1
Sequence:CCGGGCTCCACACACCTCTGATTATCTCGAGATAATCAGAGGTGTGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001089
VALIDATED
ABCA3 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001089.1-687s1c1
Sequence:CCGGGCTTGAAGATTCAGTCGGAAACTCGAGTTTCCGACTGAATCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001089.1-1024s1c1
Sequence:CCGGGTTCAGTTACACACGGAGAAACTCGAGTTTCTCCGTGTGTAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001089.1-2327s1c1
Sequence:CCGGGCATACATCAGCGGGTATGAACTCGAGTTCATACCCGCTGATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001089.1-4687s1c1
Sequence:CCGGGCTCCACACACCTCTGATTATCTCGAGATAATCAGAGGTGTGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001089.2-1177s21c1
Sequence:CCGGGTTCAGTTACACACGGAGAAACTCGAGTTTCTCCGTGTGTAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001089.2-2250s21c1
Sequence:CCGGCACTCAGAAACGAGTACTTTGCTCGAGCAAAGTACTCGTTTCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001089.2-5887s21c1
Sequence:CCGGCATCCTCTCTCTCCAAGTTTACTCGAGTAAACTTGGAGAGAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089.2-840s21c1
Sequence:CCGGGCTTGAAGATTCAGTCGGAAACTCGAGTTTCCGACTGAATCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001089.2-4840s21c1
Sequence:CCGGGCTCCACACACCTCTGATTATCTCGAGATAATCAGAGGTGTGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001089
VALIDATED
ABCA3 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001089.1-687s1c1
Sequence:CCGGGCTTGAAGATTCAGTCGGAAACTCGAGTTTCCGACTGAATCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001089.1-1024s1c1
Sequence:CCGGGTTCAGTTACACACGGAGAAACTCGAGTTTCTCCGTGTGTAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001089.1-2327s1c1
Sequence:CCGGGCATACATCAGCGGGTATGAACTCGAGTTCATACCCGCTGATGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001089.1-4687s1c1
Sequence:CCGGGCTCCACACACCTCTGATTATCTCGAGATAATCAGAGGTGTGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001089.2-1177s21c1
Sequence:CCGGGTTCAGTTACACACGGAGAAACTCGAGTTTCTCCGTGTGTAACTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001089.2-2250s21c1
Sequence:CCGGCACTCAGAAACGAGTACTTTGCTCGAGCAAAGTACTCGTTTCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001089.2-5887s21c1
Sequence:CCGGCATCCTCTCTCTCCAAGTTTACTCGAGTAAACTTGGAGAGAGAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089.2-840s21c1
Sequence:CCGGGCTTGAAGATTCAGTCGGAAACTCGAGTTTCCGACTGAATCTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001089.2-4840s21c1
Sequence:CCGGGCTCCACACACCTCTGATTATCTCGAGATAATCAGAGGTGTGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013855
VALIDATED
ABCA3 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013855.1-5628s1c1
Sequence:CCGGGCGTCCTCTCCCTCCCAGTTTCTCGAGAAACTGGGAGGGAGAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013855.1-5384s1c1
Sequence:CCGGGCACCAAGACATGGTCCATTACTCGAGTAATGGACCATGTCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013855.1-2223s1c1
Sequence:CCGGGCTTATATTCATGGGTACGAACTCGAGTTCGTACCCATGAATATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013855.1-2325s1c1
Sequence:CCGGGCCGAACATCTTTACTTCTATCTCGAGATAGAAGTAAAGATGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013855.1-920s1c1
Sequence:CCGGCTTCAGTTACACACGAAGAAACTCGAGTTTCTTCGTGTGTAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013855.2-1002s21c1
Sequence:CCGGCTTCAGTTACACACGAAGAAACTCGAGTTTCTTCGTGTGTAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013855.2-5466s21c1
Sequence:CCGGGCACCAAGACATGGTCCATTACTCGAGTAATGGACCATGTCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013855.2-2407s21c1
Sequence:CCGGGCCGAACATCTTTACTTCTATCTCGAGATAGAAGTAAAGATGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013855.2-2305s21c1
Sequence:CCGGGCTTATATTCATGGGTACGAACTCGAGTTCGTACCCATGAATATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013855
VALIDATED
ABCA3 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013855.1-5628s1c1
Sequence:CCGGGCGTCCTCTCCCTCCCAGTTTCTCGAGAAACTGGGAGGGAGAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013855.1-5384s1c1
Sequence:CCGGGCACCAAGACATGGTCCATTACTCGAGTAATGGACCATGTCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013855.1-2223s1c1
Sequence:CCGGGCTTATATTCATGGGTACGAACTCGAGTTCGTACCCATGAATATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013855.1-2325s1c1
Sequence:CCGGGCCGAACATCTTTACTTCTATCTCGAGATAGAAGTAAAGATGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013855.1-920s1c1
Sequence:CCGGCTTCAGTTACACACGAAGAAACTCGAGTTTCTTCGTGTGTAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013855.2-1002s21c1
Sequence:CCGGCTTCAGTTACACACGAAGAAACTCGAGTTTCTTCGTGTGTAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013855.2-5466s21c1
Sequence:CCGGGCACCAAGACATGGTCCATTACTCGAGTAATGGACCATGTCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013855.2-2407s21c1
Sequence:CCGGGCCGAACATCTTTACTTCTATCTCGAGATAGAAGTAAAGATGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013855.2-2305s21c1
Sequence:CCGGGCTTATATTCATGGGTACGAACTCGAGTTCGTACCCATGAATATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013855
VALIDATED
ABCA3 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013855.1-5628s1c1
Sequence:CCGGGCGTCCTCTCCCTCCCAGTTTCTCGAGAAACTGGGAGGGAGAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013855.1-5384s1c1
Sequence:CCGGGCACCAAGACATGGTCCATTACTCGAGTAATGGACCATGTCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013855.1-2223s1c1
Sequence:CCGGGCTTATATTCATGGGTACGAACTCGAGTTCGTACCCATGAATATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013855.1-2325s1c1
Sequence:CCGGGCCGAACATCTTTACTTCTATCTCGAGATAGAAGTAAAGATGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013855.1-920s1c1
Sequence:CCGGCTTCAGTTACACACGAAGAAACTCGAGTTTCTTCGTGTGTAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013855.2-1002s21c1
Sequence:CCGGCTTCAGTTACACACGAAGAAACTCGAGTTTCTTCGTGTGTAACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013855.2-5466s21c1
Sequence:CCGGGCACCAAGACATGGTCCATTACTCGAGTAATGGACCATGTCTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013855.2-2407s21c1
Sequence:CCGGGCCGAACATCTTTACTTCTATCTCGAGATAGAAGTAAAGATGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013855.2-2305s21c1
Sequence:CCGGGCTTATATTCATGGGTACGAACTCGAGTTCGTACCCATGAATATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks