EMAIL THIS PAGE TO A FRIEND

ABCA4

ATP-binding cassette, sub-family A (ABC1), member 4

52 Gene Product Result for
Synonyms: ABC10 ABCR ARMD2 CORD3 FFM RMP RP19 STGD STGD1
UniProtKB ID: P78363, O15112, O60438, O60915, Q4LE31
Gene ID:
Human(24) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is a retina-specific ABC transporter with N-retinylidene-PE as a substrate. It is expressed exclusively in retina photoreceptor cells, indicating the gene product mediates transport of an essental molecule across the photoreceptor cell membrane. Mutations in this gene are found in patients diagnosed with Stargardt disease, a form of juvenile-onset macular degeneration. Mutations in this gene are also associated with retinitis pigmentosa-19, cone-rod dystrophy type 3, early-onset severe retinal dystrophy, fundus flavimaculatus, and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
Mouse(11304) ATP-binding cassette, sub-family A (ABC1), member 4
Rat(310836) ATP-binding cassette, subfamily A (ABC1), member 4
Thale Cress(823929) ATP binding cassette subfamily A4
chicken(424490) ATP-binding cassette, sub-family A (ABC1), member 4
cow(281584) ATP-binding cassette, sub-family A (ABC1), member 4
Horse(100058746) ATP-binding cassette, sub-family A (ABC1), member 4
domestic cat(101099571) ATP-binding cassette, sub-family A (ABC1), member 4
dog(444852) ATP-binding cassette, sub-family A (ABC1), member 4
sheep(101107561) ATP-binding cassette, sub-family A (ABC1), member 4
domestic guinea pig(100725431) ATP-binding cassette, sub-family A (ABC1), member 4
naked mole-rat(101725111) ATP-binding cassette, sub-family A (ABC1), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301189 Anti-ABCA4 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000350 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101241 MISSION® esiRNA esiRNA human ABCA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000350 Rosetta Predictions human pricing
NM_001107721 Rosetta Predictions rat pricing
NM_007378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302385 predicted 5518
2 SASI_Hs01_00144139 predicted 1367
3 SASI_Hs01_00144140 predicted 6014
4 SASI_Hs02_00302386 predicted 2732
5 SASI_Hs01_00144143 predicted 2487
6 SASI_Hs01_00144144 predicted 5510
7 SASI_Hs01_00144146 predicted 2650
8 SASI_Hs02_00302387 predicted 4940
9 SASI_Hs01_00144145 predicted 6574
10 SASI_Hs02_00302388 predicted 2251
11 SASI_Hs01_00144137 predicted 1737
12 SASI_Hs01_00144138 predicted 2708
13 SASI_Hs01_00144141 predicted 4875
14 SASI_Hs01_00144142 predicted 2616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231615 predicted 6051
2 SASI_Rn02_00231616 predicted 6232
3 SASI_Rn02_00231617 predicted 3895
4 SASI_Rn02_00231618 predicted 1910
5 SASI_Rn02_00231619 predicted 5232
6 SASI_Rn02_00231620 predicted 1098
7 SASI_Rn02_00231621 predicted 3849
8 SASI_Rn02_00231622 predicted 5406
9 SASI_Rn02_00231623 predicted 5379
10 SASI_Rn02_00231624 predicted 4233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023132 predicted 2463
2 SASI_Mm01_00023133 predicted 1498
3 SASI_Mm02_00311472 predicted 1970
4 SASI_Mm01_00023134 predicted 1346
5 SASI_Mm01_00023135 predicted 1571
6 SASI_Mm01_00023136 predicted 5254
7 SASI_Mm01_00023137 predicted 4722
8 SASI_Mm02_00311473 predicted 4889
9 SASI_Mm02_00311474 predicted 907
10 SASI_Mm01_00023139 predicted 5468
11 SASI_Mm01_00023138 predicted 1105
12 SASI_Mm01_00023140 predicted 5386
13 SASI_Mm01_00023141 predicted 3997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007378
ABCA4 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007378.1-4435s21c1
Sequence:CCGGCCGGAGTACCCATGCATTAATCTCGAGATTAATGCATGGGTACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007378.1-1869s21c1
Sequence:CCGGGGCGGATCCTGTCGAAGATTTCTCGAGAAATCTTCGACAGGATCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007378.1-5262s21c1
Sequence:CCGGCAACTTCCTCTGGGATATTATCTCGAGATAATATCCCAGAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007378.1-6610s21c1
Sequence:CCGGGACGACTTGCTTCCCGATTTGCTCGAGCAAATCGGGAAGCAAGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007378.1-7032s1c1
Sequence:CCGGCTCTTTCAGAAAGAAACCAAACTCGAGTTTGGTTTCTTTCTGAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007378.1-1159s1c1
Sequence:CCGGCCCGCCTATTCTTACGACAAACTCGAGTTTGTCGTAAGAATAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007378.1-1558s1c1
Sequence:CCGGGCTGATGATATGACCAGCTTTCTCGAGAAAGCTGGTCATATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007378.1-2929s1c1
Sequence:CCGGCGTCTGAACATCACTTTCTATCTCGAGATAGAAAGTGATGTTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007378.1-4304s1c1
Sequence:CCGGCCTGGATGTATGGGCATCAATCTCGAGATTGATGCCCATACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007378
ABCA4 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007378.1-4435s21c1
Sequence:CCGGCCGGAGTACCCATGCATTAATCTCGAGATTAATGCATGGGTACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007378.1-1869s21c1
Sequence:CCGGGGCGGATCCTGTCGAAGATTTCTCGAGAAATCTTCGACAGGATCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007378.1-5262s21c1
Sequence:CCGGCAACTTCCTCTGGGATATTATCTCGAGATAATATCCCAGAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007378.1-6610s21c1
Sequence:CCGGGACGACTTGCTTCCCGATTTGCTCGAGCAAATCGGGAAGCAAGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007378.1-7032s1c1
Sequence:CCGGCTCTTTCAGAAAGAAACCAAACTCGAGTTTGGTTTCTTTCTGAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007378.1-1159s1c1
Sequence:CCGGCCCGCCTATTCTTACGACAAACTCGAGTTTGTCGTAAGAATAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007378.1-1558s1c1
Sequence:CCGGGCTGATGATATGACCAGCTTTCTCGAGAAAGCTGGTCATATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007378.1-2929s1c1
Sequence:CCGGCGTCTGAACATCACTTTCTATCTCGAGATAGAAAGTGATGTTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007378.1-4304s1c1
Sequence:CCGGCCTGGATGTATGGGCATCAATCTCGAGATTGATGCCCATACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007378
ABCA4 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007378.1-4435s21c1
Sequence:CCGGCCGGAGTACCCATGCATTAATCTCGAGATTAATGCATGGGTACTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007378.1-1869s21c1
Sequence:CCGGGGCGGATCCTGTCGAAGATTTCTCGAGAAATCTTCGACAGGATCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007378.1-5262s21c1
Sequence:CCGGCAACTTCCTCTGGGATATTATCTCGAGATAATATCCCAGAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007378.1-6610s21c1
Sequence:CCGGGACGACTTGCTTCCCGATTTGCTCGAGCAAATCGGGAAGCAAGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007378.1-7032s1c1
Sequence:CCGGCTCTTTCAGAAAGAAACCAAACTCGAGTTTGGTTTCTTTCTGAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007378.1-1159s1c1
Sequence:CCGGCCCGCCTATTCTTACGACAAACTCGAGTTTGTCGTAAGAATAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007378.1-1558s1c1
Sequence:CCGGGCTGATGATATGACCAGCTTTCTCGAGAAAGCTGGTCATATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007378.1-2929s1c1
Sequence:CCGGCGTCTGAACATCACTTTCTATCTCGAGATAGAAAGTGATGTTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007378.1-4304s1c1
Sequence:CCGGCCTGGATGTATGGGCATCAATCTCGAGATTGATGCCCATACATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000350
ABCA4 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000350.2-1372s21c1
Sequence:CCGGACGTTAGGAAGTTGGTCAAAGCTCGAGCTTTGACCAACTTCCTAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000350.2-6251s21c1
Sequence:CCGGGGTTGCAAACTGGAGTATTAACTCGAGTTAATACTCCAGTTTGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-1779s1c1
Sequence:CCGGCGTGAAGTATAAGATCCGAATCTCGAGATTCGGATCTTATACTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-2253s1c1
Sequence:CCGGCCTACATTACAGCGACCCATTCTCGAGAATGGGTCGCTGTAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-2922s1c1
Sequence:CCGGCCGTCTGAACATCACCTTCTACTCGAGTAGAAGGTGATGTTCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-3142s1c1
Sequence:CCGGGCTGAGCACATGCTGTTCTATCTCGAGATAGAACAGCATGTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-5818s1c1
Sequence:CCGGCCCATTGTTGATGAAGATGATCTCGAGATCATCTTCATCAACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000350
ABCA4 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000350.2-1372s21c1
Sequence:CCGGACGTTAGGAAGTTGGTCAAAGCTCGAGCTTTGACCAACTTCCTAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000350.2-6251s21c1
Sequence:CCGGGGTTGCAAACTGGAGTATTAACTCGAGTTAATACTCCAGTTTGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-1779s1c1
Sequence:CCGGCGTGAAGTATAAGATCCGAATCTCGAGATTCGGATCTTATACTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-2253s1c1
Sequence:CCGGCCTACATTACAGCGACCCATTCTCGAGAATGGGTCGCTGTAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-2922s1c1
Sequence:CCGGCCGTCTGAACATCACCTTCTACTCGAGTAGAAGGTGATGTTCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-3142s1c1
Sequence:CCGGGCTGAGCACATGCTGTTCTATCTCGAGATAGAACAGCATGTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-5818s1c1
Sequence:CCGGCCCATTGTTGATGAAGATGATCTCGAGATCATCTTCATCAACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000350
ABCA4 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000350.2-1372s21c1
Sequence:CCGGACGTTAGGAAGTTGGTCAAAGCTCGAGCTTTGACCAACTTCCTAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000350.2-6251s21c1
Sequence:CCGGGGTTGCAAACTGGAGTATTAACTCGAGTTAATACTCCAGTTTGCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-1779s1c1
Sequence:CCGGCGTGAAGTATAAGATCCGAATCTCGAGATTCGGATCTTATACTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-2253s1c1
Sequence:CCGGCCTACATTACAGCGACCCATTCTCGAGAATGGGTCGCTGTAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-2922s1c1
Sequence:CCGGCCGTCTGAACATCACCTTCTACTCGAGTAGAAGGTGATGTTCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-3142s1c1
Sequence:CCGGGCTGAGCACATGCTGTTCTATCTCGAGATAGAACAGCATGTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000350.1-5818s1c1
Sequence:CCGGCCCATTGTTGATGAAGATGATCTCGAGATCATCTTCATCAACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks