EMAIL THIS PAGE TO A FRIEND

ABCA5

ATP-binding cassette, sub-family A (ABC1), member 5

63 Gene Product Result for
Synonyms: ABC13 EST90625
UniProtKB ID: Q8WWZ7, Q8IVJ2, Q96LJ1, Q96MS4, Q96PZ9, Q9NY14
Gene ID:
Human(23461) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
Mouse(217265) ATP-binding cassette, sub-family A (ABC1), member 5
Rat(286970) ATP-binding cassette, subfamily A (ABC1), member 5
Zebrafish(100151075) ATP-binding cassette, sub-family A (ABC1), member 5
chicken(417444) ATP-binding cassette, sub-family A (ABC1), member 5
dog(480455) ATP-binding cassette, sub-family A (ABC1), member 5
domestic cat(101094306) ATP-binding cassette, sub-family A (ABC1), member 5
cow(510497) ATP-binding cassette, sub-family A (ABC1), member 5
naked mole-rat(101702654) ATP-binding cassette, sub-family A (ABC1), member 5
domestic guinea pig(100731147) ATP-binding cassette, sub-family A (ABC1), member 5
sheep(101115292) ATP-binding cassette, sub-family A (ABC1), member 5
Domestic Rabbit(100354723) ATP-binding cassette, sub-family A (ABC1), member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018672 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_147219 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_147219 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_147219 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087751 MISSION® esiRNA esiRNA targeting mouse Abca5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018672 Rosetta Predictions human pricing
NM_172232 Rosetta Predictions human pricing
NM_173307 Rosetta Predictions rat pricing
NM_147219 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159513 predicted 5563
2 SASI_Hs01_00159515 predicted 5267
3 SASI_Hs02_00352188 predicted 4778
4 SASI_Hs01_00159518 predicted 1643
5 SASI_Hs01_00159519 predicted 5082
6 SASI_Hs02_00352189 predicted 4148
7 SASI_Hs01_00159520 predicted 6118
8 SASI_Hs01_00159521 predicted 1708
9 SASI_Hs01_00159522 predicted 2552
10 SASI_Hs02_00352190 predicted 5160
11 SASI_Hs01_00159514 predicted 4819
12 SASI_Hs01_00159516 predicted 3556
13 SASI_Hs01_00159517 predicted 3030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012874 predicted 4457
2 SASI_Hs01_00012876 predicted 4158
3 SASI_Hs01_00012879 predicted 538
4 SASI_Hs01_00012880 predicted 3977
5 SASI_Hs02_00367942 predicted 3039
6 SASI_Hs01_00012881 predicted 5013
7 SASI_Hs01_00012882 predicted 611
8 SASI_Hs01_00012883 predicted 1450
9 SASI_Hs02_00367943 predicted 4048
10 SASI_Hs02_00367944 predicted 1644
11 SASI_Hs01_00012875 predicted 3709
12 SASI_Hs01_00012877 predicted 2451
13 SASI_Hs01_00012878 predicted 1927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103036 predicted 3357
2 SASI_Rn02_00269398 predicted 909
3 SASI_Rn01_00103037 predicted 1271
4 SASI_Rn01_00103039 predicted 2363
5 SASI_Rn01_00103040 predicted 3192
6 SASI_Rn01_00103041 predicted 4047
7 SASI_Rn01_00103042 predicted 1456
8 SASI_Rn01_00103043 predicted 3179
9 SASI_Rn01_00103044 predicted 323
10 SASI_Rn02_00269399 predicted 3027
11 SASI_Rn01_00103038 predicted 315
12 SASI_Rn01_00103045 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147219 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140417 predicted 4660
2 SASI_Mm01_00140419 predicted 3705
3 SASI_Mm01_00140420 predicted 3353
4 SASI_Mm01_00140421 predicted 1677
5 SASI_Mm01_00140422 predicted 2087
6 SASI_Mm01_00140423 predicted 2230
7 SASI_Mm02_00342704 predicted 1355
8 SASI_Mm01_00140424 predicted 3111
9 SASI_Mm02_00342705 predicted 4112
10 SASI_Mm01_00140426 predicted 1084
11 SASI_Mm01_00140418 predicted 520
12 SASI_Mm01_00140425 predicted 1388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018672
VALIDATED
ABCA5 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018672.2-2647s1c1
Sequence:CCGGGCCATAAGAATTAGTGGTATTCTCGAGAATACCACTAATTCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018672.2-5080s1c1
Sequence:CCGGCCATCCATTATGGTCAGCAATCTCGAGATTGCTGACCATAATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018672.2-5998s1c1
Sequence:CCGGGCCATTGAAGAATATAGCTTTCTCGAGAAAGCTATATTCTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018672.2-3166s1c1
Sequence:CCGGCGACATATTGTATGGAATCTTCTCGAGAAGATTCCATACAATATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018672.2-2105s1c1
Sequence:CCGGGCATTGTGATATTTCTGCTTTCTCGAGAAAGCAGAAATATCACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018672.3-1458s21c1
Sequence:CCGGATATACTCCAGTGACTAATATCTCGAGATATTAGTCACTGGAGTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018672.3-4693s21c1
Sequence:CCGGGGATACACAATTGCAACTATTCTCGAGAATAGTTGCAATTGTGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018672.3-2818s21c1
Sequence:CCGGTCTGATGGGTTTGCATCTATACTCGAGTATAGATGCAAACCCATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018672
VALIDATED
ABCA5 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018672.2-2647s1c1
Sequence:CCGGGCCATAAGAATTAGTGGTATTCTCGAGAATACCACTAATTCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018672.2-5080s1c1
Sequence:CCGGCCATCCATTATGGTCAGCAATCTCGAGATTGCTGACCATAATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018672.2-5998s1c1
Sequence:CCGGGCCATTGAAGAATATAGCTTTCTCGAGAAAGCTATATTCTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018672.2-3166s1c1
Sequence:CCGGCGACATATTGTATGGAATCTTCTCGAGAAGATTCCATACAATATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018672.2-2105s1c1
Sequence:CCGGGCATTGTGATATTTCTGCTTTCTCGAGAAAGCAGAAATATCACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018672.3-1458s21c1
Sequence:CCGGATATACTCCAGTGACTAATATCTCGAGATATTAGTCACTGGAGTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018672.3-4693s21c1
Sequence:CCGGGGATACACAATTGCAACTATTCTCGAGAATAGTTGCAATTGTGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018672.3-2818s21c1
Sequence:CCGGTCTGATGGGTTTGCATCTATACTCGAGTATAGATGCAAACCCATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018672
VALIDATED
ABCA5 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018672.2-2647s1c1
Sequence:CCGGGCCATAAGAATTAGTGGTATTCTCGAGAATACCACTAATTCTTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018672.2-5080s1c1
Sequence:CCGGCCATCCATTATGGTCAGCAATCTCGAGATTGCTGACCATAATGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018672.2-5998s1c1
Sequence:CCGGGCCATTGAAGAATATAGCTTTCTCGAGAAAGCTATATTCTTCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018672.2-3166s1c1
Sequence:CCGGCGACATATTGTATGGAATCTTCTCGAGAAGATTCCATACAATATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018672.2-2105s1c1
Sequence:CCGGGCATTGTGATATTTCTGCTTTCTCGAGAAAGCAGAAATATCACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018672.3-1458s21c1
Sequence:CCGGATATACTCCAGTGACTAATATCTCGAGATATTAGTCACTGGAGTATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018672.3-4693s21c1
Sequence:CCGGGGATACACAATTGCAACTATTCTCGAGAATAGTTGCAATTGTGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018672.3-2818s21c1
Sequence:CCGGTCTGATGGGTTTGCATCTATACTCGAGTATAGATGCAAACCCATCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147219
VALIDATED
ABCA5 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 5
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147219.1-5161s1c1
Sequence:CCGGCCGACCCTGAGTTGGTTTATTCTCGAGAATAAACCAACTCAGGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147219.1-4071s1c1
Sequence:CCGGCCAGCCATTATGGTATGCAATCTCGAGATTGCATACCATAATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147219.1-3011s1c1
Sequence:CCGGCCAGAACATAATGGTGGCAATCTCGAGATTGCCACCATTATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147219.1-5114s1c1
Sequence:CCGGGCAGGAGGATAGAGTAGTATTCTCGAGAATACTACTCTATCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147219.1-499s1c1
Sequence:CCGGCCGATCATCTTCCCAAGGTTACTCGAGTAACCTTGGGAAGATGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147219.2-5560s21c1
Sequence:CCGGAGACCAGTGCCTGACTAATAACTCGAGTTATTAGTCAGGCACTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147219.2-492s21c1
Sequence:CCGGACACTCCCGTGACTAACATTACTCGAGTAATGTTAGTCACGGGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147219.2-5535s21c1
Sequence:CCGGTGTAATTTCCCAGTGCTAATTCTCGAGAATTAGCACTGGGAAATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147219.2-2235s21c1
Sequence:CCGGCTAACAGAGTGACCGTGTTTACTCGAGTAAACACGGTCACTCTGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147219.2-1608s21c1
Sequence:CCGGGCAACATTAATGGCAATATTACTCGAGTAATATTGCCATTAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147219.2-4351s21c1
Sequence:CCGGTGAAGATGACGAATCCATTAACTCGAGTTAATGGATTCGTCATCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147219
VALIDATED
ABCA5 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 5
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147219.1-5161s1c1
Sequence:CCGGCCGACCCTGAGTTGGTTTATTCTCGAGAATAAACCAACTCAGGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147219.1-4071s1c1
Sequence:CCGGCCAGCCATTATGGTATGCAATCTCGAGATTGCATACCATAATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147219.1-3011s1c1
Sequence:CCGGCCAGAACATAATGGTGGCAATCTCGAGATTGCCACCATTATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147219.1-5114s1c1
Sequence:CCGGGCAGGAGGATAGAGTAGTATTCTCGAGAATACTACTCTATCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147219.1-499s1c1
Sequence:CCGGCCGATCATCTTCCCAAGGTTACTCGAGTAACCTTGGGAAGATGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147219.2-5560s21c1
Sequence:CCGGAGACCAGTGCCTGACTAATAACTCGAGTTATTAGTCAGGCACTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147219.2-492s21c1
Sequence:CCGGACACTCCCGTGACTAACATTACTCGAGTAATGTTAGTCACGGGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147219.2-5535s21c1
Sequence:CCGGTGTAATTTCCCAGTGCTAATTCTCGAGAATTAGCACTGGGAAATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147219.2-2235s21c1
Sequence:CCGGCTAACAGAGTGACCGTGTTTACTCGAGTAAACACGGTCACTCTGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147219.2-1608s21c1
Sequence:CCGGGCAACATTAATGGCAATATTACTCGAGTAATATTGCCATTAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147219.2-4351s21c1
Sequence:CCGGTGAAGATGACGAATCCATTAACTCGAGTTAATGGATTCGTCATCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147219
VALIDATED
ABCA5 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 5
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113460    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147219.1-5161s1c1
Sequence:CCGGCCGACCCTGAGTTGGTTTATTCTCGAGAATAAACCAACTCAGGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147219.1-4071s1c1
Sequence:CCGGCCAGCCATTATGGTATGCAATCTCGAGATTGCATACCATAATGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147219.1-3011s1c1
Sequence:CCGGCCAGAACATAATGGTGGCAATCTCGAGATTGCCACCATTATGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_147219.1-5114s1c1
Sequence:CCGGGCAGGAGGATAGAGTAGTATTCTCGAGAATACTACTCTATCCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147219.1-499s1c1
Sequence:CCGGCCGATCATCTTCCCAAGGTTACTCGAGTAACCTTGGGAAGATGATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147219.2-5560s21c1
Sequence:CCGGAGACCAGTGCCTGACTAATAACTCGAGTTATTAGTCAGGCACTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147219.2-492s21c1
Sequence:CCGGACACTCCCGTGACTAACATTACTCGAGTAATGTTAGTCACGGGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147219.2-5535s21c1
Sequence:CCGGTGTAATTTCCCAGTGCTAATTCTCGAGAATTAGCACTGGGAAATTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147219.2-2235s21c1
Sequence:CCGGCTAACAGAGTGACCGTGTTTACTCGAGTAAACACGGTCACTCTGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147219.2-1608s21c1
Sequence:CCGGGCAACATTAATGGCAATATTACTCGAGTAATATTGCCATTAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147219.2-4351s21c1
Sequence:CCGGTGAAGATGACGAATCCATTAACTCGAGTTAATGGATTCGTCATCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks