EMAIL THIS PAGE TO A FRIEND

ABCA6

ATP-binding cassette, sub-family A (ABC1), member 6

78 Gene Product Result for
Synonyms: EST155051
UniProtKB ID: Q8N139, Q6NSH9, Q8N856, Q8WWZ6
Gene ID:
Human(23460) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Mouse(76184) ATP-binding cassette, sub-family A (ABC1), member 6
Rat(303639) ATP-binding cassette, subfamily A (ABC1), member 6
sheep(101115555) ATP-binding cassette, sub-family A (ABC1), member 6
domestic guinea pig(100715575) ATP-binding cassette, sub-family A (ABC1), member 6
naked mole-rat(101724434) ATP-binding cassette, sub-family A (ABC1), member 6
dog(480456) ATP-binding cassette, sub-family A (ABC1), member 6
domestic cat(101089558) ATP-binding cassette, sub-family A (ABC1), member 6
cow(537351) ATP-binding cassette, sub-family A (ABC1), member 6
Horse(100062487) ATP-binding cassette, sub-family A (ABC1), member 6
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_147218 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_147218 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_147218 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080284 Rosetta Predictions human pricing
XM_001081607 Rosetta Predictions rat pricing
XM_221102 Rosetta Predictions rat pricing
NM_147218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030169 predicted 3022
2 SASI_Hs01_00030170 predicted 3905
3 SASI_Hs01_00030171 predicted 4996
4 SASI_Hs01_00030172 predicted 3175
5 SASI_Hs01_00030173 predicted 1953
6 SASI_Hs01_00030174 predicted 627
7 SASI_Hs01_00030175 predicted 1656
8 SASI_Hs01_00030176 predicted 4346
9 SASI_Hs01_00030177 predicted 745
10 SASI_Hs01_00030178 predicted 2295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372659 predicted 3416
2 SASI_Rn02_00372660 predicted 4353
3 SASI_Rn02_00372661 predicted 540
4 SASI_Rn02_00372662 predicted 3612
5 SASI_Rn02_00372663 predicted 1670
6 SASI_Rn02_00372664 predicted 857
7 SASI_Rn02_00372665 predicted 4345
8 SASI_Rn02_00372666 predicted 3908
9 SASI_Rn02_00372667 predicted 1755
10 SASI_Rn02_00372668 predicted 4194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151556 predicted 983
2 SASI_Rn01_00151557 predicted 2094
3 SASI_Rn01_00151558 predicted 486
4 SASI_Rn01_00151559 predicted 560
5 SASI_Rn01_00151560 predicted 876
6 SASI_Rn01_00151561 predicted 1681
7 SASI_Rn01_00151562 predicted 287
8 SASI_Rn01_00151563 predicted 702
9 SASI_Rn01_00151564 predicted 3233
10 SASI_Rn01_00151565 predicted 1974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026014 predicted 3387
2 SASI_Mm01_00026015 predicted 619
3 SASI_Mm02_00342701 predicted 2075
4 SASI_Mm01_00026017 predicted 3001
5 SASI_Mm02_00342702 predicted 263
6 SASI_Mm01_00026018 predicted 2675
7 SASI_Mm01_00026019 predicted 583
8 SASI_Mm01_00026020 predicted 1300
9 SASI_Mm01_00026021 predicted 1086
10 SASI_Mm02_00342703 predicted 2337
11 SASI_Mm01_00026016 predicted 3785
12 SASI_Mm01_00026022 predicted 4692
13 SASI_Mm01_00026023 predicted 1345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080284
ABCA6 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080284.2-1951s21c1
Sequence:CCGGACAAGAGGTACAACGAATATTCTCGAGAATATTCGTTGTACCTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080284.2-1509s21c1
Sequence:CCGGGGACTAATGCTAAGGTTATTGCTCGAGCAATAACCTTAGCATTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080284.2-2755s21c1
Sequence:CCGGGGTATTTGGAATCGCAATATTCTCGAGAATATTGCGATTCCAAATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-4405s1c1
Sequence:CCGGGCAGAAATTAACAGCAGGAATCTCGAGATTCCTGCTGTTAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-1453s1c1
Sequence:CCGGGCGCCATTATTCTCCTTTATTCTCGAGAATAAAGGAGAATAATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-3023s1c1
Sequence:CCGGGCTATCATAGTTTCTGGTAAACTCGAGTTTACCAGAAACTATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-3782s1c1
Sequence:CCGGCCCTACTTTCAGACTTTGCTACTCGAGTAGCAAAGTCTGAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-2701s1c1
Sequence:CCGGGCTCCGTTTCTTAAAGTTAAACTCGAGTTTAACTTTAAGAAACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080284
ABCA6 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080284.2-1951s21c1
Sequence:CCGGACAAGAGGTACAACGAATATTCTCGAGAATATTCGTTGTACCTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080284.2-1509s21c1
Sequence:CCGGGGACTAATGCTAAGGTTATTGCTCGAGCAATAACCTTAGCATTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080284.2-2755s21c1
Sequence:CCGGGGTATTTGGAATCGCAATATTCTCGAGAATATTGCGATTCCAAATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-4405s1c1
Sequence:CCGGGCAGAAATTAACAGCAGGAATCTCGAGATTCCTGCTGTTAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-1453s1c1
Sequence:CCGGGCGCCATTATTCTCCTTTATTCTCGAGAATAAAGGAGAATAATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-3023s1c1
Sequence:CCGGGCTATCATAGTTTCTGGTAAACTCGAGTTTACCAGAAACTATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-3782s1c1
Sequence:CCGGCCCTACTTTCAGACTTTGCTACTCGAGTAGCAAAGTCTGAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-2701s1c1
Sequence:CCGGGCTCCGTTTCTTAAAGTTAAACTCGAGTTTAACTTTAAGAAACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080284
ABCA6 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080284.2-1951s21c1
Sequence:CCGGACAAGAGGTACAACGAATATTCTCGAGAATATTCGTTGTACCTCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080284.2-1509s21c1
Sequence:CCGGGGACTAATGCTAAGGTTATTGCTCGAGCAATAACCTTAGCATTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080284.2-2755s21c1
Sequence:CCGGGGTATTTGGAATCGCAATATTCTCGAGAATATTGCGATTCCAAATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-4405s1c1
Sequence:CCGGGCAGAAATTAACAGCAGGAATCTCGAGATTCCTGCTGTTAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-1453s1c1
Sequence:CCGGGCGCCATTATTCTCCTTTATTCTCGAGAATAAAGGAGAATAATGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-3023s1c1
Sequence:CCGGGCTATCATAGTTTCTGGTAAACTCGAGTTTACCAGAAACTATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-3782s1c1
Sequence:CCGGCCCTACTTTCAGACTTTGCTACTCGAGTAGCAAAGTCTGAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080284.2-2701s1c1
Sequence:CCGGGCTCCGTTTCTTAAAGTTAAACTCGAGTTTAACTTTAAGAAACGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147218
ABCA6 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-522s1c1
Sequence:CCGGGCACAATATACCGGACGCTTTCTCGAGAAAGCGTCCGGTATATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-277s1c1
Sequence:CCGGCCAATTATTATAGGACTGCATCTCGAGATGCAGTCCTATAATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-887s1c1
Sequence:CCGGGCAATGTTACTAAAGAGAGAACTCGAGTTCTCTCTTTAGTAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-1334s1c1
Sequence:CCGGCCTCAGGAGAATCCTATGTAACTCGAGTTACATAGGATTCTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-2477s1c1
Sequence:CCGGGCTTGATGAGTTATGAAGTTTCTCGAGAAACTTCATAACTCATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147218
ABCA6 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-522s1c1
Sequence:CCGGGCACAATATACCGGACGCTTTCTCGAGAAAGCGTCCGGTATATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-277s1c1
Sequence:CCGGCCAATTATTATAGGACTGCATCTCGAGATGCAGTCCTATAATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-887s1c1
Sequence:CCGGGCAATGTTACTAAAGAGAGAACTCGAGTTCTCTCTTTAGTAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-1334s1c1
Sequence:CCGGCCTCAGGAGAATCCTATGTAACTCGAGTTACATAGGATTCTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-2477s1c1
Sequence:CCGGGCTTGATGAGTTATGAAGTTTCTCGAGAAACTTCATAACTCATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147218
ABCA6 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-522s1c1
Sequence:CCGGGCACAATATACCGGACGCTTTCTCGAGAAAGCGTCCGGTATATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-277s1c1
Sequence:CCGGCCAATTATTATAGGACTGCATCTCGAGATGCAGTCCTATAATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-887s1c1
Sequence:CCGGGCAATGTTACTAAAGAGAGAACTCGAGTTCTCTCTTTAGTAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-1334s1c1
Sequence:CCGGCCTCAGGAGAATCCTATGTAACTCGAGTTACATAGGATTCTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147218.1-2477s1c1
Sequence:CCGGGCTTGATGAGTTATGAAGTTTCTCGAGAAACTTCATAACTCATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks