EMAIL THIS PAGE TO A FRIEND

ABCA8

ATP-binding cassette, sub-family A (ABC1), member 8

68 Gene Product Result for
UniProtKB ID: O94911, Q86WW0
Gene ID:
Human(10351) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The function of this protein has not yet been determined. [provided by RefSeq, Jul 2008]
Rat(303637) ATP-binding cassette, subfamily A (ABC1), member 8
chicken(417440) ATP-binding cassette, sub-family A (ABC1), member 8
domestic cat(101093561) ATP-binding cassette, sub-family A (ABC1), member 8
Horse(100062560) ATP-binding cassette, sub-family A (ABC1), member 8
dog(490898) ATP-binding cassette, sub-family A (ABC1), member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007168 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066341 MISSION® esiRNA esiRNA human ABCA8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007168 Rosetta Predictions human pricing
XM_001081601 Rosetta Predictions rat pricing
XM_221074 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343102 predicted 2930
2 SASI_Hs01_00025214 predicted 2227
3 SASI_Hs01_00025215 predicted 627
4 SASI_Hs01_00025216 predicted 3061
5 SASI_Hs01_00025217 predicted 1040
6 SASI_Hs01_00025218 predicted 3956
7 SASI_Hs01_00025219 predicted 3049
8 SASI_Hs01_00025220 predicted 206
9 SASI_Hs01_00025222 predicted 1702
10 SASI_Hs01_00025223 predicted 2653
11 SASI_Hs01_00025221 predicted 2823
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372599 predicted 1706
2 SASI_Rn02_00372600 predicted 622
3 SASI_Rn02_00372601 predicted 1639
4 SASI_Rn02_00372602 predicted 2559
5 SASI_Rn02_00372603 predicted 1263
6 SASI_Rn02_00372604 predicted 1213
7 SASI_Rn02_00372605 predicted 1447
8 SASI_Rn02_00372606 predicted 4828
9 SASI_Rn02_00372607 predicted 4770
10 SASI_Rn02_00372608 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221074 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379784 predicted 421
2 SASI_Rn02_00379785 predicted 1701
3 SASI_Rn02_00379786 predicted 631
4 SASI_Rn02_00379787 predicted 1638
5 SASI_Rn02_00379788 predicted 1862
6 SASI_Rn02_00379789 predicted 1266
7 SASI_Rn02_00379790 predicted 1214
8 SASI_Rn02_00379791 predicted 1447
9 SASI_Rn02_00379792 predicted 4831
10 SASI_Rn02_00379793 predicted 4771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007168
ABCA8 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007168.2-3111s1c1
Sequence:CCGGCCAATCGGATTCCTGGCATATCTCGAGATATGCCAGGAATCCGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007168.2-5417s1c1
Sequence:CCGGCATGGGTCATAGTATCTGATACTCGAGTATCAGATACTATGACCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007168.2-4743s1c1
Sequence:CCGGGCCCAAGCTTTCTTCAAATTACTCGAGTAATTTGAAGAAAGCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007168.2-4048s1c1
Sequence:CCGGGCACATCCATTAAGGTGATAACTCGAGTTATCACCTTAATGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007168.2-207s1c1
Sequence:CCGGCAACAAACTTGGGCCTTATTACTCGAGTAATAAGGCCCAAGTTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007168.2-2734s1c1
Sequence:CCGGCCTGGGAACTTTCTCCTCATTCTCGAGAATGAGGAGAAAGTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007168.2-1700s1c1
Sequence:CCGGCGAAGGCCAAATCACTGCAATCTCGAGATTGCAGTGATTTGGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007168.2-4930s1c1
Sequence:CCGGCCAAATTCTGTGTTCCTGTTTCTCGAGAAACAGGAACACAGAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007168.2-3006s1c1
Sequence:CCGGCCAGTTCTTATGGACATTGTTCTCGAGAACAATGTCCATAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007168
ABCA8 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007168.2-3111s1c1
Sequence:CCGGCCAATCGGATTCCTGGCATATCTCGAGATATGCCAGGAATCCGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007168.2-5417s1c1
Sequence:CCGGCATGGGTCATAGTATCTGATACTCGAGTATCAGATACTATGACCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007168.2-4743s1c1
Sequence:CCGGGCCCAAGCTTTCTTCAAATTACTCGAGTAATTTGAAGAAAGCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007168.2-4048s1c1
Sequence:CCGGGCACATCCATTAAGGTGATAACTCGAGTTATCACCTTAATGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007168.2-207s1c1
Sequence:CCGGCAACAAACTTGGGCCTTATTACTCGAGTAATAAGGCCCAAGTTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007168.2-2734s1c1
Sequence:CCGGCCTGGGAACTTTCTCCTCATTCTCGAGAATGAGGAGAAAGTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007168.2-1700s1c1
Sequence:CCGGCGAAGGCCAAATCACTGCAATCTCGAGATTGCAGTGATTTGGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007168.2-4930s1c1
Sequence:CCGGCCAAATTCTGTGTTCCTGTTTCTCGAGAAACAGGAACACAGAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007168.2-3006s1c1
Sequence:CCGGCCAGTTCTTATGGACATTGTTCTCGAGAACAATGTCCATAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007168
ABCA8 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007168.2-3111s1c1
Sequence:CCGGCCAATCGGATTCCTGGCATATCTCGAGATATGCCAGGAATCCGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007168.2-5417s1c1
Sequence:CCGGCATGGGTCATAGTATCTGATACTCGAGTATCAGATACTATGACCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007168.2-4743s1c1
Sequence:CCGGGCCCAAGCTTTCTTCAAATTACTCGAGTAATTTGAAGAAAGCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007168.2-4048s1c1
Sequence:CCGGGCACATCCATTAAGGTGATAACTCGAGTTATCACCTTAATGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007168.2-207s1c1
Sequence:CCGGCAACAAACTTGGGCCTTATTACTCGAGTAATAAGGCCCAAGTTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007168.2-2734s1c1
Sequence:CCGGCCTGGGAACTTTCTCCTCATTCTCGAGAATGAGGAGAAAGTTCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007168.2-1700s1c1
Sequence:CCGGCGAAGGCCAAATCACTGCAATCTCGAGATTGCAGTGATTTGGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007168.2-4930s1c1
Sequence:CCGGCCAAATTCTGTGTTCCTGTTTCTCGAGAAACAGGAACACAGAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007168.2-3006s1c1
Sequence:CCGGCCAGTTCTTATGGACATTGTTCTCGAGAACAATGTCCATAAGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks