EMAIL THIS PAGE TO A FRIEND

ABCA9

ATP-binding cassette, sub-family A (ABC1), member 9

93 Gene Product Result for
Synonyms: EST640918
UniProtKB ID: Q8IUA7, Q6P655, Q8N2S4, Q8WWZ5, Q96MD8
Gene ID:
Human(10350) Summary: This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]
Mouse(217262) ATP-binding cassette, sub-family A (ABC1), member 9
Rat(287788) ATP-binding cassette, subfamily A (ABC1), member 9
naked mole-rat(101724076) ATP-binding cassette, sub-family A (ABC1), member 9
domestic guinea pig(100729515) ATP-binding cassette, sub-family A (ABC1), member 9
sheep(101115808) ATP-binding cassette, sub-family A (ABC1), member 9
chicken(417443) ATP-binding cassette, sub-family A (ABC1), member 9
Horse(100062524) ATP-binding cassette, sub-family A (ABC1), member 9
cow(504278) ATP-binding cassette, sub-family A (ABC1), member 9
domestic cat(101089158) ATP-binding cassette, sub-family A (ABC1), member 9
dog(611016) ATP-binding cassette, sub-family A (ABC1), member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_147220 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_147220 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_147220 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080283 Rosetta Predictions human pricing
XM_001081605 Rosetta Predictions rat pricing
XM_221101 Rosetta Predictions rat pricing
NM_147220 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026712 predicted 3585
2 SASI_Hs02_00362210 predicted 3664
3 SASI_Hs01_00026713 predicted 1521
4 SASI_Hs01_00026714 predicted 5087
5 SASI_Hs02_00362211 predicted 3011
6 SASI_Hs01_00026717 predicted 3738
7 SASI_Hs01_00026718 predicted 2449
8 SASI_Hs01_00026719 predicted 1260
9 SASI_Hs01_00026720 predicted 3600
10 SASI_Hs02_00362212 predicted 2779
11 SASI_Hs01_00026715 predicted 1760
12 SASI_Hs01_00026716 predicted 3005
13 SASI_Hs01_00026721 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372639 predicted 951
2 SASI_Rn02_00372640 predicted 549
3 SASI_Rn02_00372641 predicted 1137
4 SASI_Rn02_00372642 predicted 1985
5 SASI_Rn02_00372643 predicted 3443
6 SASI_Rn02_00372644 predicted 1944
7 SASI_Rn02_00372645 predicted 3352
8 SASI_Rn02_00372646 predicted 3567
9 SASI_Rn02_00372647 predicted 1505
10 SASI_Rn02_00372648 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379844 predicted 953
2 SASI_Rn02_00379845 predicted 551
3 SASI_Rn02_00379846 predicted 2035
4 SASI_Rn02_00379847 predicted 3489
5 SASI_Rn02_00379848 predicted 1989
6 SASI_Rn02_00379849 predicted 1738
7 SASI_Rn02_00379850 predicted 2182
8 SASI_Rn02_00379851 predicted 3409
9 SASI_Rn02_00379852 predicted 3611
10 SASI_Rn02_00379853 predicted 4537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082284 predicted 3123
2 SASI_Mm02_00342706 predicted 2987
3 SASI_Mm01_00082285 predicted 1442
4 SASI_Mm01_00082286 predicted 3814
5 SASI_Mm01_00082287 predicted 1385
6 SASI_Mm01_00082288 predicted 3027
7 SASI_Mm01_00082290 predicted 3711
8 SASI_Mm02_00342707 predicted 2570
9 SASI_Mm02_00342708 predicted 1371
10 SASI_Mm01_00082291 predicted 5157
11 SASI_Mm01_00082282 predicted 462
12 SASI_Mm01_00082283 predicted 810
13 SASI_Mm01_00082289 predicted 972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080283
ABCA9 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080283.3-2944s21c1
Sequence:CCGGGGCGACAGAACATAGCTATAGCTCGAGCTATAGCTATGTTCTGTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080283.3-3593s21c1
Sequence:CCGGGATAGTTGCTACTGATCTAAACTCGAGTTTAGATCAGTAGCAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-3002s1c1
Sequence:CCGGCCCATCTTACAATGGTGCTATCTCGAGATAGCACCATTGTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-612s1c1
Sequence:CCGGGCTCACTGTCAAGCAGTGAATCTCGAGATTCACTGCTTGACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-3386s1c1
Sequence:CCGGCCTCCTGCTAATGCAAATAATCTCGAGATTATTTGCATTAGCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-2105s1c1
Sequence:CCGGCCGAATATGGAATCTCCTGAACTCGAGTTCAGGAGATTCCATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-4008s1c1
Sequence:CCGGCGGAAGGAATATGCAGGCAAACTCGAGTTTGCCTGCATATTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080283
ABCA9 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080283.3-2944s21c1
Sequence:CCGGGGCGACAGAACATAGCTATAGCTCGAGCTATAGCTATGTTCTGTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080283.3-3593s21c1
Sequence:CCGGGATAGTTGCTACTGATCTAAACTCGAGTTTAGATCAGTAGCAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-3002s1c1
Sequence:CCGGCCCATCTTACAATGGTGCTATCTCGAGATAGCACCATTGTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-612s1c1
Sequence:CCGGGCTCACTGTCAAGCAGTGAATCTCGAGATTCACTGCTTGACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-3386s1c1
Sequence:CCGGCCTCCTGCTAATGCAAATAATCTCGAGATTATTTGCATTAGCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-2105s1c1
Sequence:CCGGCCGAATATGGAATCTCCTGAACTCGAGTTCAGGAGATTCCATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-4008s1c1
Sequence:CCGGCGGAAGGAATATGCAGGCAAACTCGAGTTTGCCTGCATATTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080283
ABCA9 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080283.3-2944s21c1
Sequence:CCGGGGCGACAGAACATAGCTATAGCTCGAGCTATAGCTATGTTCTGTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080283.3-3593s21c1
Sequence:CCGGGATAGTTGCTACTGATCTAAACTCGAGTTTAGATCAGTAGCAACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-3002s1c1
Sequence:CCGGCCCATCTTACAATGGTGCTATCTCGAGATAGCACCATTGTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-612s1c1
Sequence:CCGGGCTCACTGTCAAGCAGTGAATCTCGAGATTCACTGCTTGACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-3386s1c1
Sequence:CCGGCCTCCTGCTAATGCAAATAATCTCGAGATTATTTGCATTAGCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-2105s1c1
Sequence:CCGGCCGAATATGGAATCTCCTGAACTCGAGTTCAGGAGATTCCATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080283.2-4008s1c1
Sequence:CCGGCGGAAGGAATATGCAGGCAAACTCGAGTTTGCCTGCATATTCCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147220
ABCA9 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family A (ABC1), member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147220.1-5209s1c1
Sequence:CCGGCGGTGTGCAAACAGCTTAGAACTCGAGTTCTAAGCTGTTTGCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147220.1-3558s1c1
Sequence:CCGGGCCTGTTGATTCAGATCCCATCTCGAGATGGGATCTGAATCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147220.1-2382s1c1
Sequence:CCGGGCTATCATCTAAGTTTGCATTCTCGAGAATGCAAACTTAGATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147220.1-4260s1c1
Sequence:CCGGGCATGATAACAGGAGACACAACTCGAGTTGTGTCTCCTGTTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147220.1-2250s1c1
Sequence:CCGGGCAGAGTAATTGTCTTCAGTACTCGAGTACTGAAGACAATTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147220
ABCA9 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family A (ABC1), member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147220.1-5209s1c1
Sequence:CCGGCGGTGTGCAAACAGCTTAGAACTCGAGTTCTAAGCTGTTTGCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147220.1-3558s1c1
Sequence:CCGGGCCTGTTGATTCAGATCCCATCTCGAGATGGGATCTGAATCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147220.1-2382s1c1
Sequence:CCGGGCTATCATCTAAGTTTGCATTCTCGAGAATGCAAACTTAGATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147220.1-4260s1c1
Sequence:CCGGGCATGATAACAGGAGACACAACTCGAGTTGTGTCTCCTGTTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147220.1-2250s1c1
Sequence:CCGGGCAGAGTAATTGTCTTCAGTACTCGAGTACTGAAGACAATTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147220
ABCA9 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family A (ABC1), member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_147220.1-5209s1c1
Sequence:CCGGCGGTGTGCAAACAGCTTAGAACTCGAGTTCTAAGCTGTTTGCACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147220.1-3558s1c1
Sequence:CCGGGCCTGTTGATTCAGATCCCATCTCGAGATGGGATCTGAATCAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147220.1-2382s1c1
Sequence:CCGGGCTATCATCTAAGTTTGCATTCTCGAGAATGCAAACTTAGATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147220.1-4260s1c1
Sequence:CCGGGCATGATAACAGGAGACACAACTCGAGTTGTGTCTCCTGTTATCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_147220.1-2250s1c1
Sequence:CCGGGCAGAGTAATTGTCTTCAGTACTCGAGTACTGAAGACAATTACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks