EMAIL THIS PAGE TO A FRIEND

ABCB10

ATP-binding cassette, sub-family B (MDR/TAP), member 10

86 Gene Product Result for
Synonyms: EST20237 M-ABC2 MTABC2
UniProtKB ID: Q9NRK6, Q13040, Q6P1Q8, Q9H3V0
Gene ID:
Human(23456) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The function of this mitochondrial protein is unknown. [provided by RefSeq, Jul 2008]
Mouse(56199) ATP-binding cassette, sub-family B (MDR/TAP), member 10
Rat(361439) ATP-binding cassette, subfamily B (MDR/TAP), member 10
naked mole-rat(101711816) ATP-binding cassette, sub-family B (MDR/TAP), member 10
domestic guinea pig(100723284) ATP-binding cassette, sub-family B (MDR/TAP), member 10
sheep(101102120) ATP-binding cassette, sub-family B (MDR/TAP), member 10
Zebrafish(100003744) ATP-binding cassette, sub-family B (MDR/TAP), member 10
cow(789800) ATP-binding cassette, sub-family B (MDR/TAP), member 10
Horse(100065938) ATP-binding cassette, sub-family B (MDR/TAP), member 10
domestic cat(101095197) ATP-binding cassette, sub-family B (MDR/TAP), member 10
dog(100682973) ATP-binding cassette, sub-family B (MDR/TAP), member 10
chicken(421537) ATP-binding cassette, sub-family B (MDR/TAP), member 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012089 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047911 MISSION® esiRNA esiRNA human ABCB10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012089 Rosetta Predictions human pricing
NM_001012166 Rosetta Predictions rat pricing
XM_574253 Rosetta Predictions rat pricing
NM_019552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017946 predicted 1169
2 SASI_Hs02_00343580 predicted 1007
3 SASI_Hs02_00343581 predicted 1189
4 SASI_Hs01_00017949 predicted 2078
5 SASI_Hs01_00017950 predicted 1688
6 SASI_Hs01_00017953 predicted 1947
7 SASI_Hs02_00343582 predicted 1511
8 SASI_Hs02_00343583 predicted 2094
9 SASI_Hs02_00343584 predicted 1703
10 SASI_Hs02_00343585 predicted 1102
11 SASI_Hs01_00017944 predicted 938
12 SASI_Hs01_00017945 predicted 1274
13 SASI_Hs01_00017947 predicted 1332
14 SASI_Hs01_00017948 predicted 1154
15 SASI_Hs01_00017951 predicted 1509
16 SASI_Hs01_00017952 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120585 predicted 1503
2 SASI_Rn01_00120586 predicted 2055
3 SASI_Rn01_00120587 predicted 2000
4 SASI_Rn01_00120588 predicted 936
5 SASI_Rn01_00120589 predicted 2084
6 SASI_Rn01_00120590 predicted 1676
7 SASI_Rn01_00120591 predicted 953
8 SASI_Rn01_00120592 predicted 2046
9 SASI_Rn01_00120593 predicted 1552
10 SASI_Rn02_00200361 predicted 1739
11 SASI_Rn01_00120594 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126119 predicted 1866
2 SASI_Rn01_00126120 predicted 1287
3 SASI_Rn01_00126121 predicted 1971
4 SASI_Rn01_00126122 predicted 2030
5 SASI_Rn01_00126123 predicted 1316
6 SASI_Rn01_00126124 predicted 1913
7 SASI_Rn01_00126125 predicted 1075
8 SASI_Rn01_00126126 predicted 1241
9 SASI_Rn01_00126127 predicted 1986
10 SASI_Rn01_00126128 predicted 2100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178005 predicted 1727
2 SASI_Mm01_00178006 predicted 782
3 SASI_Mm01_00178007 predicted 2343
4 SASI_Mm01_00178008 predicted 385
5 SASI_Mm01_00178009 predicted 2280
6 SASI_Mm01_00178010 predicted 2464
7 SASI_Mm01_00178011 predicted 1682
8 SASI_Mm01_00178012 predicted 1699
9 SASI_Mm01_00178013 predicted 2501
10 SASI_Mm01_00178014 predicted 1977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012089
VALIDATED
ABCB10 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_012089.1-1028s1c1
Sequence:CCGGGCTGTAATTTATGGGCGATATCTCGAGATATCGCCCATAAATTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_012089.1-1708s1c1
Sequence:CCGGCCATGACATCCGTCAGCTAAACTCGAGTTTAGCTGACGGATGTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_012089.1-564s1c1
Sequence:CCGGCGGTTGGATTTCTCACGATGTCTCGAGACATCGTGAGAAATCCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012089.1-1176s1c1
Sequence:CCGGCCAGCAAAGTGGACCATGTAACTCGAGTTACATGGTCCACTTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012089.2-1098s21c1
Sequence:CCGGAGCTAGCTGAGGAACGTATTGCTCGAGCAATACGTTCCTCAGCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012089.2-2111s21c1
Sequence:CCGGCATCGTCTGTCCACCATTAAGCTCGAGCTTAATGGTGGACAGACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012089.2-1519s21c1
Sequence:GTACCGGGGAGTTTAAGAACGTGCATTTCTCGAGAAATGCACGTTCTTAAACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012089.2-2730s21c1
Sequence:CCGGTAACCCTTTATTCCGATAATCCTCGAGGATTATCGGAATAAAGGGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012089.2-1879s21c1
Sequence:CCGGAGTGGCCTTCATCCGGAATTTCTCGAGAAATTCCGGATGAAGGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012089
VALIDATED
ABCB10 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_012089.1-1028s1c1
Sequence:CCGGGCTGTAATTTATGGGCGATATCTCGAGATATCGCCCATAAATTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_012089.1-1708s1c1
Sequence:CCGGCCATGACATCCGTCAGCTAAACTCGAGTTTAGCTGACGGATGTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_012089.1-564s1c1
Sequence:CCGGCGGTTGGATTTCTCACGATGTCTCGAGACATCGTGAGAAATCCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012089.1-1176s1c1
Sequence:CCGGCCAGCAAAGTGGACCATGTAACTCGAGTTACATGGTCCACTTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012089.2-1098s21c1
Sequence:CCGGAGCTAGCTGAGGAACGTATTGCTCGAGCAATACGTTCCTCAGCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012089.2-2111s21c1
Sequence:CCGGCATCGTCTGTCCACCATTAAGCTCGAGCTTAATGGTGGACAGACGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012089.2-1519s21c1
Sequence:GTACCGGGGAGTTTAAGAACGTGCATTTCTCGAGAAATGCACGTTCTTAAACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012089.2-2730s21c1
Sequence:CCGGTAACCCTTTATTCCGATAATCCTCGAGGATTATCGGAATAAAGGGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012089.2-1879s21c1
Sequence:CCGGAGTGGCCTTCATCCGGAATTTCTCGAGAAATTCCGGATGAAGGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012089
VALIDATED
ABCB10 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_012089.1-1028s1c1
Sequence:CCGGGCTGTAATTTATGGGCGATATCTCGAGATATCGCCCATAAATTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_012089.1-1708s1c1
Sequence:CCGGCCATGACATCCGTCAGCTAAACTCGAGTTTAGCTGACGGATGTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_012089.1-564s1c1
Sequence:CCGGCGGTTGGATTTCTCACGATGTCTCGAGACATCGTGAGAAATCCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012089.1-1176s1c1
Sequence:CCGGCCAGCAAAGTGGACCATGTAACTCGAGTTACATGGTCCACTTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012089.2-1098s21c1
Sequence:CCGGAGCTAGCTGAGGAACGTATTGCTCGAGCAATACGTTCCTCAGCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012089.2-2111s21c1
Sequence:CCGGCATCGTCTGTCCACCATTAAGCTCGAGCTTAATGGTGGACAGACGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012089.2-1519s21c1
Sequence:GTACCGGGGAGTTTAAGAACGTGCATTTCTCGAGAAATGCACGTTCTTAAACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231040    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012089.2-2730s21c1
Sequence:CCGGTAACCCTTTATTCCGATAATCCTCGAGGATTATCGGAATAAAGGGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012089.2-1879s21c1
Sequence:CCGGAGTGGCCTTCATCCGGAATTTCTCGAGAAATTCCGGATGAAGGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019552
VALIDATED
ABCB10 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019552.2-1868s1c1
Sequence:CCGGGCCATGACATTCGTCAGCTAACTCGAGTTAGCTGACGAATGTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019552.2-1512s1c1
Sequence:CCGGGTACGCTTTCTGGGTTGGATTCTCGAGAATCCAACCCAGAAAGCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019552.2-1189s1c1
Sequence:CCGGGCTGTGATTTATGGGCGATATCTCGAGATATCGCCCATAAATCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019552.2-3291s1c1
Sequence:CCGGGCCTTGAGTATGATGACTCTTCTCGAGAAGAGTCATCATACTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019552.2-2296s1c1
Sequence:CCGGGCCAACTTTGTTGCTGTCCTTCTCGAGAAGGACAGCAACAAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019552.2-1189s21c1
Sequence:CCGGGCTGTGATTTATGGGCGATATCTCGAGATATCGCCCATAAATCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019552.2-2296s21c1
Sequence:CCGGGCCAACTTTGTTGCTGTCCTTCTCGAGAAGGACAGCAACAAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019552.2-1826s21c1
Sequence:CCGGTGCGGTTGTACGACCCTAATTCTCGAGAATTAGGGTCGTACAACCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019552.2-998s21c1
Sequence:CCGGAGACCCGCACAGGCGAATTAACTCGAGTTAATTCGCCTGTGCGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019552.2-2545s21c1
Sequence:CCGGCGTGGGCTGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCAGCCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019552
VALIDATED
ABCB10 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019552.2-1868s1c1
Sequence:CCGGGCCATGACATTCGTCAGCTAACTCGAGTTAGCTGACGAATGTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019552.2-1512s1c1
Sequence:CCGGGTACGCTTTCTGGGTTGGATTCTCGAGAATCCAACCCAGAAAGCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019552.2-1189s1c1
Sequence:CCGGGCTGTGATTTATGGGCGATATCTCGAGATATCGCCCATAAATCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019552.2-3291s1c1
Sequence:CCGGGCCTTGAGTATGATGACTCTTCTCGAGAAGAGTCATCATACTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019552.2-2296s1c1
Sequence:CCGGGCCAACTTTGTTGCTGTCCTTCTCGAGAAGGACAGCAACAAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019552.2-1189s21c1
Sequence:CCGGGCTGTGATTTATGGGCGATATCTCGAGATATCGCCCATAAATCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019552.2-2296s21c1
Sequence:CCGGGCCAACTTTGTTGCTGTCCTTCTCGAGAAGGACAGCAACAAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019552.2-1826s21c1
Sequence:CCGGTGCGGTTGTACGACCCTAATTCTCGAGAATTAGGGTCGTACAACCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019552.2-998s21c1
Sequence:CCGGAGACCCGCACAGGCGAATTAACTCGAGTTAATTCGCCTGTGCGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019552.2-2545s21c1
Sequence:CCGGCGTGGGCTGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCAGCCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019552
VALIDATED
ABCB10 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019552.2-1868s1c1
Sequence:CCGGGCCATGACATTCGTCAGCTAACTCGAGTTAGCTGACGAATGTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019552.2-1512s1c1
Sequence:CCGGGTACGCTTTCTGGGTTGGATTCTCGAGAATCCAACCCAGAAAGCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019552.2-1189s1c1
Sequence:CCGGGCTGTGATTTATGGGCGATATCTCGAGATATCGCCCATAAATCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019552.2-3291s1c1
Sequence:CCGGGCCTTGAGTATGATGACTCTTCTCGAGAAGAGTCATCATACTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019552.2-2296s1c1
Sequence:CCGGGCCAACTTTGTTGCTGTCCTTCTCGAGAAGGACAGCAACAAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019552.2-1189s21c1
Sequence:CCGGGCTGTGATTTATGGGCGATATCTCGAGATATCGCCCATAAATCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019552.2-2296s21c1
Sequence:CCGGGCCAACTTTGTTGCTGTCCTTCTCGAGAAGGACAGCAACAAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019552.2-1826s21c1
Sequence:CCGGTGCGGTTGTACGACCCTAATTCTCGAGAATTAGGGTCGTACAACCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019552.2-998s21c1
Sequence:CCGGAGACCCGCACAGGCGAATTAACTCGAGTTAATTCGCCTGTGCGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019552.2-2545s21c1
Sequence:CCGGCGTGGGCTGAGAGACCTTAAACTCGAGTTTAAGGTCTCTCAGCCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)