EMAIL THIS PAGE TO A FRIEND

ABCB11

ATP-binding cassette, sub-family B (MDR/TAP), member 11

68 Gene Product Result for
Synonyms: ABC16 BRIC2 BSEP PFIC-2 PFIC2 PGY4 SPGP
UniProtKB ID: O95342, Q53TL2, Q9UNB2
Gene ID:
Human(8647) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt export pump in man. Mutations in this gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
Mouse(27413) ATP-binding cassette, sub-family B (MDR/TAP), member 11
Rat(83569) ATP-binding cassette, subfamily B (MDR/TAP), member 11
chicken(424170) ATP-binding cassette, sub-family B (MDR/TAP), member 11
cow(531150) ATP-binding cassette, sub-family B (MDR/TAP), member 11
Horse(100052359) ATP-binding cassette, sub-family B (MDR/TAP), member 11
domestic cat(101085737) ATP-binding cassette, sub-family B (MDR/TAP), member 11
dog(488390) ATP-binding cassette, sub-family B (MDR/TAP), member 11
sheep(101121238) ATP-binding cassette, sub-family B (MDR/TAP), member 11
Domestic Rabbit(100008767) ATP-binding cassette, sub-family B (MDR/TAP), member 11
domestic guinea pig(100337637) ATP-binding cassette, sub-family B (MDR/TAP), member 11
naked mole-rat(101716542) ATP-binding cassette, sub-family B (MDR/TAP), member 11
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003742 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041451 MISSION® esiRNA esiRNA human ABCB11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003742 Rosetta Predictions human pricing
NM_031760 Rosetta Predictions rat pricing
XM_579531 Rosetta Predictions rat pricing
NM_021022 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336198 predicted 2645
2 SASI_Hs01_00137173 predicted 3520
3 SASI_Hs01_00137174 predicted 229
4 SASI_Hs02_00336199 predicted 2560
5 SASI_Hs01_00137175 predicted 920
6 SASI_Hs01_00137176 predicted 2096
7 SASI_Hs01_00137177 predicted 3160
8 SASI_Hs01_00137178 predicted 677
9 SASI_Hs01_00137179 predicted 563
10 SASI_Hs01_00137180 predicted 3623
11 SASI_Hs01_00137171 predicted 455
12 SASI_Hs01_00137172 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098008 predicted 4184
2 SASI_Rn01_00098009 predicted 315
3 SASI_Rn01_00098010 predicted 3261
4 SASI_Rn01_00098011 predicted 4102
5 SASI_Rn02_00265176 predicted 2127
6 SASI_Rn02_00265177 predicted 2143
7 SASI_Rn01_00098013 predicted 934
8 SASI_Rn02_00265178 predicted 1233
9 SASI_Rn01_00098014 predicted 708
10 SASI_Rn01_00098015 predicted 1828
11 SASI_Rn01_00098012 predicted 2970
12 SASI_Rn01_00098016 predicted 2069
13 SASI_Rn01_00098017 predicted 2783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579531 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408576 predicted 1257
2 SASI_Rn02_00408577 predicted 592
3 SASI_Rn02_00408578 predicted 1363
4 SASI_Rn02_00408579 predicted 323
5 SASI_Rn02_00408580 predicted 1322
6 SASI_Rn02_00408581 predicted 1876
7 SASI_Rn02_00408582 predicted 2179
8 SASI_Rn02_00408583 predicted 1667
9 SASI_Rn02_00408584 predicted 1653
10 SASI_Rn02_00408585 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141559 predicted 3972
2 SASI_Mm01_00141560 predicted 3132
3 SASI_Mm01_00141561 predicted 1578
4 SASI_Mm01_00141562 predicted 487
5 SASI_Mm01_00141564 predicted 1951
6 SASI_Mm01_00141565 predicted 4043
7 SASI_Mm01_00141566 predicted 1354
8 SASI_Mm01_00141568 predicted 1099
9 SASI_Mm02_00325769 predicted 4019
10 SASI_Mm02_00325770 predicted 578
11 SASI_Mm01_00141563 predicted 570
12 SASI_Mm01_00141567 predicted 1356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003742
ABCB11 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003742.2-2179s21c1
Sequence:CCGGGGGAGCTACCAGGATAGTTTACTCGAGTAAACTATCCTGGTAGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003742.2-1940s21c1
Sequence:CCAGAGCATGGGCACACAATCATTTCTCGAGAAATGATTGTGTGCCCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003742.2-2259s21c1
Sequence:CCGGATTAGCTGTTGTAGATCATAACTCGAGTTATGATCTACAACAGCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003742.2-3125s21c1
Sequence:CCGGACAGATATGGAGGTTACTTAACTCGAGTTAAGTAACCTCCATATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003742.2-1574s1c1
Sequence:CCGGGCCATGACATTCGCTCTCTTACTCGAGTAAGAGAGCGAATGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003742.2-3738s1c1
Sequence:CCGGCCCAGAGAAATATGAAACTAACTCGAGTTAGTTTCATATTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003742.2-3584s1c1
Sequence:CCGGGCTCAAACATTGGAATTGTTTCTCGAGAAACAATTCCAATGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003742.2-550s1c1
Sequence:CCGGGCCAGTTACTATGCTGGAATTCTCGAGAATTCCAGCATAGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003742
ABCB11 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003742.2-2179s21c1
Sequence:CCGGGGGAGCTACCAGGATAGTTTACTCGAGTAAACTATCCTGGTAGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003742.2-1940s21c1
Sequence:CCAGAGCATGGGCACACAATCATTTCTCGAGAAATGATTGTGTGCCCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003742.2-2259s21c1
Sequence:CCGGATTAGCTGTTGTAGATCATAACTCGAGTTATGATCTACAACAGCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003742.2-3125s21c1
Sequence:CCGGACAGATATGGAGGTTACTTAACTCGAGTTAAGTAACCTCCATATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003742.2-1574s1c1
Sequence:CCGGGCCATGACATTCGCTCTCTTACTCGAGTAAGAGAGCGAATGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003742.2-3738s1c1
Sequence:CCGGCCCAGAGAAATATGAAACTAACTCGAGTTAGTTTCATATTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003742.2-3584s1c1
Sequence:CCGGGCTCAAACATTGGAATTGTTTCTCGAGAAACAATTCCAATGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003742.2-550s1c1
Sequence:CCGGGCCAGTTACTATGCTGGAATTCTCGAGAATTCCAGCATAGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003742
ABCB11 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003742.2-2179s21c1
Sequence:CCGGGGGAGCTACCAGGATAGTTTACTCGAGTAAACTATCCTGGTAGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003742.2-1940s21c1
Sequence:CCAGAGCATGGGCACACAATCATTTCTCGAGAAATGATTGTGTGCCCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003742.2-2259s21c1
Sequence:CCGGATTAGCTGTTGTAGATCATAACTCGAGTTATGATCTACAACAGCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003742.2-3125s21c1
Sequence:CCGGACAGATATGGAGGTTACTTAACTCGAGTTAAGTAACCTCCATATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003742.2-1574s1c1
Sequence:CCGGGCCATGACATTCGCTCTCTTACTCGAGTAAGAGAGCGAATGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003742.2-3738s1c1
Sequence:CCGGCCCAGAGAAATATGAAACTAACTCGAGTTAGTTTCATATTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003742.2-3584s1c1
Sequence:CCGGGCTCAAACATTGGAATTGTTTCTCGAGAAACAATTCCAATGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003742.2-550s1c1
Sequence:CCGGGCCAGTTACTATGCTGGAATTCTCGAGAATTCCAGCATAGTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021022
ABCB11 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021022.2-3551s1c1
Sequence:CCGGCCTCCGTTCAAACATTGGGATCTCGAGATCCCAATGTTTGAACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021022.2-4250s1c1
Sequence:CCGGCCAGAGTCACTGTGAGTTCAACTCGAGTTGAACTCACAGTGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021022.2-1546s1c1
Sequence:CCGGGCCATGACATTCGTTCTCTTACTCGAGTAAGAGAACGAATGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021022.2-327s1c1
Sequence:CCGGCCAGGCATGATTATTGTGTTTCTCGAGAAACACAATAATCATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021022.2-2014s1c1
Sequence:CCGGCCCATGAAGAACTGTTAGAAACTCGAGTTTCTAACAGTTCTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021022
ABCB11 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021022.2-3551s1c1
Sequence:CCGGCCTCCGTTCAAACATTGGGATCTCGAGATCCCAATGTTTGAACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021022.2-4250s1c1
Sequence:CCGGCCAGAGTCACTGTGAGTTCAACTCGAGTTGAACTCACAGTGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021022.2-1546s1c1
Sequence:CCGGGCCATGACATTCGTTCTCTTACTCGAGTAAGAGAACGAATGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021022.2-327s1c1
Sequence:CCGGCCAGGCATGATTATTGTGTTTCTCGAGAAACACAATAATCATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021022.2-2014s1c1
Sequence:CCGGCCCATGAAGAACTGTTAGAAACTCGAGTTTCTAACAGTTCTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021022
ABCB11 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021022.2-3551s1c1
Sequence:CCGGCCTCCGTTCAAACATTGGGATCTCGAGATCCCAATGTTTGAACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021022.2-4250s1c1
Sequence:CCGGCCAGAGTCACTGTGAGTTCAACTCGAGTTGAACTCACAGTGACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021022.2-1546s1c1
Sequence:CCGGGCCATGACATTCGTTCTCTTACTCGAGTAAGAGAACGAATGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021022.2-327s1c1
Sequence:CCGGCCAGGCATGATTATTGTGTTTCTCGAGAAACACAATAATCATGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021022.2-2014s1c1
Sequence:CCGGCCCATGAAGAACTGTTAGAAACTCGAGTTTCTAACAGTTCTTCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks