EMAIL THIS PAGE TO A FRIEND

ABCB1

ATP-binding cassette, sub-family B (MDR/TAP), member 1

95 Gene Product Result for
Synonyms: ABC20 CD243 CLCS GP170 MDR1 P-GP PGY1
UniProtKB ID: P08183, A8K294, Q12755, Q14812
Gene ID:
Human(5243) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is an ATP-dependent drug efflux pump for xenobiotic compounds with broad substrate specificity. It is responsible for decreased drug accumulation in multidrug-resistant cells and often mediates the development of resistance to anticancer drugs. This protein also functions as a transporter in the blood-brain barrier. [provided by RefSeq, Jul 2008]
Thale Cress(818265) ABC transporter B family member 1
cow(281585) ATP-binding cassette, sub-family B (MDR/TAP), member 1
Horse(100034074) ATP-binding cassette, sub-family B (MDR/TAP), member 1
domestic cat(493707) ATP-binding cassette, sub-family B (MDR/TAP), member 1
dog(403879) ATP-binding cassette, sub-family B (MDR/TAP), member 1
sheep(443367) ATP-binding cassette, sub-family B (MDR/TAP), member 1
Domestic Rabbit(100008914) ATP-binding cassette, sub-family B (MDR/TAP), member 1
domestic guinea pig(100733532) ATP-binding cassette, sub-family B (MDR/TAP), member 1
naked mole-rat(101702843) ATP-binding cassette, sub-family B (MDR/TAP), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
150215 9(10H)-Acridanone 99% human pricing
H35900 9-Hydroxy-4-methoxyacridine human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
142662 Chlorosulfonyl isocyanate 98% human pricing
O104 Omeprazole solid human pricing
C6019 Clotrimazole human, mouse pricing
33894 Clotrimazole VETRANAL, analytical standard human, mouse pricing
C3915 Colchicine BioReagent, plant cell culture tested, ≥95% (HPLC) human, mouse pricing
C9754 Colchicine ≥95% (HPLC), powder human, mouse pricing
E6376 Erythromycin potency: ≥850 μg per mg human, mouse pricing
E5389 Erythromycin BioReagent, suitable for cell culture human, mouse pricing
45674 Erythromycin tested according to Ph.Eur. human, mouse pricing
E0774 Erythromycin meets USP testing specifications human, mouse pricing
E7904 Erythromycin Biotechnology Performance Certified human, mouse pricing
I8898 Ivermectin human, mouse pricing
B7005 Betamethasone ≥98% human, mouse, rat pricing
34166 Betamethasone VETRANAL, analytical standard human, mouse, rat pricing
B9675 Betamethasone meets USP testing specifications human, mouse, rat pricing
C4522 Cimetidine human, mouse, rat pricing
D1756 Dexamethasone ≥98% (HPLC), powder human, mouse, rat pricing
D4902 Dexamethasone powder, BioReagent, suitable for cell culture, ≥97% human, mouse, rat pricing
D8893 Dexamethasone powder, γ-irradiated, BioXtra, suitable for cell culture, ≥80% (HPLC) human, mouse, rat pricing
D9184 Dexamethasone meets USP testing specifications human, mouse, rat pricing
46165 Dexamethasone VETRANAL, analytical standard human, mouse, rat pricing
31375 Dexamethasone tested according to Ph.Eur. human, mouse, rat pricing
D6003 Digoxin analytical standard human, mouse, rat pricing
D6770 Digoxin analytical standard human, mouse, rat pricing
E1383 Etoposide synthetic, ≥98%, powder human, mouse, rat pricing
H4001 Hydrocortisone ≥98% (HPLC) human, mouse, rat pricing
H0135 Hydrocortisone γ-irradiated, powder, BioXtra, suitable for cell culture human, mouse, rat pricing
H0888 Hydrocortisone BioReagent, suitable for cell culture human, mouse, rat pricing
H3160 Hydrocortisone meets USP testing specifications human, mouse, rat pricing
H6909 Hydrocortisone solution 50 μM, sterile-filtered, BioXtra, suitable for cell culture human, mouse, rat pricing
H0396 Hydrocortisone-Water Soluble BioReagent, suitable for cell culture human, mouse, rat pricing
K1003 Ketoconazole ≥98% (HPLC) human, mouse, rat pricing
UC280 Ketoconazole human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
P1793 Pimozide human, mouse, rat pricing
P0130 Progesterone ≥99% human, mouse, rat pricing
P6149 Progesterone γ-irradiated, BioXtra, suitable for cell culture human, mouse, rat pricing
P8783 Progesterone powder, BioReagent, suitable for cell culture human, mouse, rat pricing
P3972 Progesterone meets USP testing specifications human, mouse, rat pricing
46665 Progesterone VETRANAL, analytical standard human, mouse, rat pricing
P7556 Progesterone-Water Soluble powder, BioReagent, suitable for cell culture human, mouse, rat pricing
Q3625 Quinidine anhydrous human, mouse, rat pricing
22600 Quinidine crystallized, ≥98.0% (dried material, NT) human, mouse, rat pricing
T9652 Terfenadine human, mouse, rat pricing
H1512 Haloperidol powder human, rat pricing
22620 Quinine suitable for fluorescence, anhydrous, ≥98.0% (dried material, NT) human, rat pricing
145904 Quinine 90% human, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
P4670 Propafenone hydrochloride human pricing

Kits

Product # Description Species Add to Cart
 
MAK161 Multidrug Resistance Assay Kit (Fluorometric MDR Assay) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000927 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131661 MISSION® esiRNA esiRNA human ABCB1 (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
MAB4336 Anti-MDR1 Antibody, clone 5A12.2 100 µg, This Anti-MDR1 Antibody, clone 5A12.2 is validated for use in IH, IH(P) for the detection of MDR1. pricing
MAB4338 Anti-MDR1 Antibody, clone 6C4.2 100 µg, Detect MDR1 using this Anti-MDR1 Antibody, clone 6C4.2 validated for use in IH(P). pricing
MAB4120 Anti-MDR1 Antibody, clone JSB-1 100 µg, Anti-MDR1 Antibody, clone JSB-1 detects level of MDR1 & has been published & validated for use in FC, IC, IH(P) & WB. pricing
MAB4334Z Anti-MDR1 Antibody, clone UIC2, azide free 100 µg, Detect MDR1 using this Anti-MDR1 Antibody, clone UIC2, azide free validated for use in FC, IF, IP, IH. pricing
MAB4334B Anti-MDR1 Antibody, clone UIC2, biotin conjugated 100 µg, Anti-MDR1 Antibody, clone UIC2, biotin conjugated detects level of MDR1 & has been published & validated for use in FC, IP, IH, IH(P). pricing
MAB4334 Anti-MDR1 Antibody, conformational extracellular epitope, clone UIC2 100 µg, Anti-MDR1 Antibody, conformational extracellular epitope, clone UIC2 detects level of MDR1 & has been published & validated for use in FC, IF, IP, IH, IH(P). pricing
MAB4163 Anti-MDR1 Antibody, extracellular human specific Pgp, clone MC57 100 µg, Anti-MDR1 Antibody, extracellular human specific Pgp, clone MC57 detects level of MDR1 & has been published & validated for use in FC, IH, IH(P). pricing
MAB4161 Anti-MDR1 Antibody, extracellular human specific Pgp, clone MM12.10 100 µg, Detect MDR1 using this Anti-MDR1 Antibody, extracellular human specific Pgp, clone MM12.10 validated for use in FC, IH(P). pricing
MAB4162 Anti-MDR1 Antibody, extracellular human specific Pgp, clone MM4.17 100 µg, Anti-MDR1 Antibody, extracellular human specific Pgp, clone MM4.17 is an antibody against MDR1 for use in FC, IH. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000927 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087519 predicted 1785
2 SASI_Hs01_00087520 predicted 2982
3 SASI_Hs01_00087521 predicted 737
4 SASI_Hs01_00087522 predicted 1568
5 SASI_Hs01_00087523 predicted 2174
6 SASI_Hs02_00303513 predicted 981
7 SASI_Hs01_00087525 predicted 2873
8 SASI_Hs02_00303514 predicted 3166
9 SASI_Hs01_00087527 predicted 893
10 SASI_Hs02_00303515 predicted 2968
11 SASI_Hs01_00087524 predicted 1539
12 SASI_Hs01_00087526 predicted 3906
13 SASI_Hs01_00087528 predicted 4262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000927
ABCB1 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-3500s1c1
Sequence:CCGGCCGAACACATTGGAAGGAAATCTCGAGATTTCCTTCCAATGTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-1193s1c1
Sequence:CCGGGCAGCAATTAGAACTGTGATTCTCGAGAATCACAGTTCTAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-2174s1c1
Sequence:CCGGGCTCATCGTTTGTCTACAGTTCTCGAGAACTGTAGACAAACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-1319s1c1
Sequence:CCGGGCTGCTTTCCTGCTGATCTATCTCGAGATAGATCAGCAGGAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-2663s1c1
Sequence:CCGGCGACAGAATAGTAACTTGTTTCTCGAGAAACAAGTTACTATTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000927
ABCB1 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-3500s1c1
Sequence:CCGGCCGAACACATTGGAAGGAAATCTCGAGATTTCCTTCCAATGTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-1193s1c1
Sequence:CCGGGCAGCAATTAGAACTGTGATTCTCGAGAATCACAGTTCTAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-2174s1c1
Sequence:CCGGGCTCATCGTTTGTCTACAGTTCTCGAGAACTGTAGACAAACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-1319s1c1
Sequence:CCGGGCTGCTTTCCTGCTGATCTATCTCGAGATAGATCAGCAGGAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-2663s1c1
Sequence:CCGGCGACAGAATAGTAACTTGTTTCTCGAGAAACAAGTTACTATTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000927
ABCB1 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-3500s1c1
Sequence:CCGGCCGAACACATTGGAAGGAAATCTCGAGATTTCCTTCCAATGTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-1193s1c1
Sequence:CCGGGCAGCAATTAGAACTGTGATTCTCGAGAATCACAGTTCTAATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-2174s1c1
Sequence:CCGGGCTCATCGTTTGTCTACAGTTCTCGAGAACTGTAGACAAACGATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-1319s1c1
Sequence:CCGGGCTGCTTTCCTGCTGATCTATCTCGAGATAGATCAGCAGGAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000927.3-2663s1c1
Sequence:CCGGCGACAGAATAGTAACTTGTTTCTCGAGAAACAAGTTACTATTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks