EMAIL THIS PAGE TO A FRIEND

ABCB4

ATP-binding cassette, sub-family B (MDR/TAP), member 4

81 Gene Product Result for
Synonyms: ABC21 GBD1 ICP3 MDR2 MDR2/3 MDR3 PFIC-3 PGY3
Gene ID:
Human(5244) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
Mouse(18670) ATP-binding cassette, sub-family B (MDR/TAP), member 4
Rat(24891) ATP-binding cassette, subfamily B (MDR/TAP), member 4
Zebrafish(100136865) ATP-binding cassette, sub-family B (MDR/TAP), member 4
dog(482284) ATP-binding cassette, sub-family B (MDR/TAP), member 4
domestic cat(101100709) ATP-binding cassette, sub-family B (MDR/TAP), member 4
cow(100336913) ATP-binding cassette, sub-family B (MDR/TAP), member 4
cow(783154) ATP-binding cassette, sub-family B (MDR/TAP), member 4
cow(100336338) ATP-binding cassette, sub-family B (MDR/TAP), member 4
Thale Cress(819314) auxin efflux transmembrane transporter MDR4
naked mole-rat(101717251) ATP-binding cassette, sub-family B (MDR/TAP), member 4
domestic guinea pig(100722900) ATP-binding cassette, sub-family B (MDR/TAP), member 4
sheep(101122517) ATP-binding cassette, sub-family B (MDR/TAP), member 4
Domestic Rabbit(100354947) ATP-binding cassette, sub-family B (MDR/TAP), member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000443 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000443 Rosetta Predictions human pricing
NM_018849 Rosetta Predictions human pricing
NM_018850 Rosetta Predictions human pricing
NM_012690 Rosetta Predictions rat pricing
NM_008830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232875 predicted 2637
2 SASI_Hs01_00232877 predicted 1471
3 SASI_Hs01_00232876 predicted 551
4 SASI_Hs01_00232878 predicted 2593
5 SASI_Hs02_00302562 predicted 2210
6 SASI_Hs02_00302563 predicted 3617
7 SASI_Hs01_00232879 predicted 713
8 SASI_Hs01_00232880 predicted 2105
9 SASI_Hs01_00232881 predicted 3648
10 SASI_Hs01_00232882 predicted 777
11 SASI_Hs01_00232883 predicted 5477
12 SASI_Hs01_00232884 predicted 2384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189998 predicted 2636
2 SASI_Hs01_00190000 predicted 1471
3 SASI_Hs01_00189999 predicted 551
4 SASI_Hs01_00190001 predicted 2597
5 SASI_Hs02_00352312 predicted 2213
6 SASI_Hs02_00352313 predicted 3646
7 SASI_Hs01_00190002 predicted 706
8 SASI_Hs01_00190003 predicted 2097
9 SASI_Hs01_00190004 predicted 3674
10 SASI_Hs01_00190005 predicted 775
11 SASI_Hs01_00190006 predicted 5490
12 SASI_Hs01_00190007 predicted 2385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026604 predicted 2633
2 SASI_Hs01_00026606 predicted 1472
3 SASI_Hs01_00026605 predicted 550
4 SASI_Hs01_00026607 predicted 2597
5 SASI_Hs02_00352314 predicted 2218
6 SASI_Hs02_00352315 predicted 3480
7 SASI_Hs01_00026608 predicted 710
8 SASI_Hs01_00026609 predicted 2098
9 SASI_Hs01_00026610 predicted 3506
10 SASI_Hs01_00026611 predicted 774
11 SASI_Hs01_00026612 predicted 5337
12 SASI_Hs01_00026613 predicted 2385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012690 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049496 predicted 3099
2 SASI_Rn01_00049497 predicted 498
3 SASI_Rn01_00049498 predicted 2799
4 SASI_Rn01_00049499 predicted 971
5 SASI_Rn01_00049500 predicted 3000
6 SASI_Rn01_00049501 predicted 1448
7 SASI_Rn01_00049502 predicted 855
8 SASI_Rn01_00049503 predicted 2541
9 SASI_Rn01_00049504 predicted 1372
10 SASI_Rn02_00259999 predicted 2709
11 SASI_Rn01_00049505 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117011 predicted 2040
2 SASI_Mm01_00117014 predicted 1239
3 SASI_Mm01_00117015 predicted 301
4 SASI_Mm01_00117016 predicted 1949
5 SASI_Mm01_00117017 predicted 864
6 SASI_Mm01_00117018 predicted 695
7 SASI_Mm02_00314767 predicted 1110
8 SASI_Mm01_00117019 predicted 2701
9 SASI_Mm02_00314768 predicted 2863
10 SASI_Mm01_00117020 predicted 1175
11 SASI_Mm01_00117012 predicted 1130
12 SASI_Mm01_00117013 predicted 1016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008830
ABCB4 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-659s1c1
Sequence:CCGGCGACAAGAAATGGGCTGGTTTCTCGAGAAACCAGCCCATTTCTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-1274s1c1
Sequence:CCGGGCCTATGTGATCTTTGACATTCTCGAGAATGTCAAAGATCACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-2210s1c1
Sequence:CCGGCCACATCAGAATAGGCTGGATCTCGAGATCCAGCCTATTCTGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-2160s1c1
Sequence:CCGGGCTGGAAAGCACGCATATTTACTCGAGTAAATATGCGTGCTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-3197s1c1
Sequence:CCGGGCATACTTGTTCAGCCTGTTTCTCGAGAAACAGGCTGAACAAGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008830
ABCB4 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-659s1c1
Sequence:CCGGCGACAAGAAATGGGCTGGTTTCTCGAGAAACCAGCCCATTTCTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-1274s1c1
Sequence:CCGGGCCTATGTGATCTTTGACATTCTCGAGAATGTCAAAGATCACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-2210s1c1
Sequence:CCGGCCACATCAGAATAGGCTGGATCTCGAGATCCAGCCTATTCTGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-2160s1c1
Sequence:CCGGGCTGGAAAGCACGCATATTTACTCGAGTAAATATGCGTGCTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-3197s1c1
Sequence:CCGGGCATACTTGTTCAGCCTGTTTCTCGAGAAACAGGCTGAACAAGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008830
ABCB4 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-659s1c1
Sequence:CCGGCGACAAGAAATGGGCTGGTTTCTCGAGAAACCAGCCCATTTCTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-1274s1c1
Sequence:CCGGGCCTATGTGATCTTTGACATTCTCGAGAATGTCAAAGATCACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-2210s1c1
Sequence:CCGGCCACATCAGAATAGGCTGGATCTCGAGATCCAGCCTATTCTGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-2160s1c1
Sequence:CCGGGCTGGAAAGCACGCATATTTACTCGAGTAAATATGCGTGCTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008830.1-3197s1c1
Sequence:CCGGGCATACTTGTTCAGCCTGTTTCTCGAGAAACAGGCTGAACAAGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000443
ABCB4 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-4885s1c1
Sequence:CCGGGCCCACTTATTCATGCTGTTTCTCGAGAAACAGCATGAATAAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-3842s1c1
Sequence:CCGGGCTGGAAATCTCGCCTATTTACTCGAGTAAATAGGCGAGATTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-2347s1c1
Sequence:CCGGCGACAGGAAATAGGATGGTTTCTCGAGAAACCATCCTATTTCCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-5435s1c1
Sequence:CCGGCCCTCATCAGACAACCTCAAACTCGAGTTTGAGGTTGTCTGATGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-2575s1c1
Sequence:CCGGGCAAAGATACTCTCGGCATTTCTCGAGAAATGCCGAGAGTATCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000443.3-2595s21c1
Sequence:CCGGCTAACCTTGGAACTGGTATTACTCGAGTAATACCAGTTCCAAGGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000443.3-455s21c1
Sequence:CCGGGTTCTTGTTGCTGCCTATATACTCGAGTATATAGGCAGCAACAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000443
ABCB4 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-4885s1c1
Sequence:CCGGGCCCACTTATTCATGCTGTTTCTCGAGAAACAGCATGAATAAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-3842s1c1
Sequence:CCGGGCTGGAAATCTCGCCTATTTACTCGAGTAAATAGGCGAGATTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-2347s1c1
Sequence:CCGGCGACAGGAAATAGGATGGTTTCTCGAGAAACCATCCTATTTCCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-5435s1c1
Sequence:CCGGCCCTCATCAGACAACCTCAAACTCGAGTTTGAGGTTGTCTGATGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-2575s1c1
Sequence:CCGGGCAAAGATACTCTCGGCATTTCTCGAGAAATGCCGAGAGTATCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000443.3-2595s21c1
Sequence:CCGGCTAACCTTGGAACTGGTATTACTCGAGTAATACCAGTTCCAAGGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000443.3-455s21c1
Sequence:CCGGGTTCTTGTTGCTGCCTATATACTCGAGTATATAGGCAGCAACAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000443
ABCB4 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-4885s1c1
Sequence:CCGGGCCCACTTATTCATGCTGTTTCTCGAGAAACAGCATGAATAAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-3842s1c1
Sequence:CCGGGCTGGAAATCTCGCCTATTTACTCGAGTAAATAGGCGAGATTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-2347s1c1
Sequence:CCGGCGACAGGAAATAGGATGGTTTCTCGAGAAACCATCCTATTTCCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-5435s1c1
Sequence:CCGGCCCTCATCAGACAACCTCAAACTCGAGTTTGAGGTTGTCTGATGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000443.2-2575s1c1
Sequence:CCGGGCAAAGATACTCTCGGCATTTCTCGAGAAATGCCGAGAGTATCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000443.3-2595s21c1
Sequence:CCGGCTAACCTTGGAACTGGTATTACTCGAGTAATACCAGTTCCAAGGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000443.3-455s21c1
Sequence:CCGGGTTCTTGTTGCTGCCTATATACTCGAGTATATAGGCAGCAACAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)