EMAIL THIS PAGE TO A FRIEND

ABCB5

ATP-binding cassette, sub-family B (MDR/TAP), member 5

91 Gene Product Result for
Synonyms: ABCB5alpha ABCB5beta EST422562
Gene ID:
Human(340273) Summary: ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]
Mouse(77706) ATP-binding cassette, sub-family B (MDR/TAP), member 5
Rat(314537) ATP-binding cassette, subfamily B (MDR/TAP), member 5
Domestic Rabbit(100346799) ATP-binding cassette, sub-family B (MDR/TAP), member 5
Zebrafish(798527) ATP-binding cassette, sub-family B (MDR/TAP), member 5
domestic cat(101087982) ATP-binding cassette, sub-family B (MDR/TAP), member 5
Horse(100067103) ATP-binding cassette, sub-family B (MDR/TAP), member 5
dog(482344) ATP-binding cassette, sub-family B (MDR/TAP), member 5
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178559 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029961 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029961 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029961 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU158101 MISSION® esiRNA esiRNA targeting mouse Abcb5 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178559 Rosetta Predictions human pricing
XM_001062082 Rosetta Predictions rat pricing
XM_234725 Rosetta Predictions rat pricing
XM_001002680 Rosetta Predictions mouse pricing
XM_906632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369808 predicted 1148
2 SASI_Hs01_00187047 predicted 1997
3 SASI_Hs02_00369809 predicted 941
4 SASI_Hs01_00187049 predicted 1984
5 SASI_Hs01_00187050 predicted 636
6 SASI_Hs02_00369810 predicted 2406
7 SASI_Hs01_00187053 predicted 808
8 SASI_Hs01_00187054 predicted 712
9 SASI_Hs01_00187055 predicted 2505
10 SASI_Hs01_00187056 predicted 675
11 SASI_Hs01_00187048 predicted 971
12 SASI_Hs01_00187051 predicted 2419
13 SASI_Hs01_00187052 predicted 1700
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302347 predicted 1760
2 SASI_Rn02_00302348 predicted 1033
3 SASI_Rn02_00302349 predicted 374
4 SASI_Rn02_00302350 predicted 568
5 SASI_Rn02_00302351 predicted 400
6 SASI_Rn02_00302352 predicted 3481
7 SASI_Rn02_00302353 predicted 3563
8 SASI_Rn02_00302354 predicted 2690
9 SASI_Rn02_00302355 predicted 1222
10 SASI_Rn02_00302356 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388657 predicted 1761
2 SASI_Rn02_00388658 predicted 1036
3 SASI_Rn02_00388659 predicted 378
4 SASI_Rn02_00388660 predicted 562
5 SASI_Rn02_00388661 predicted 405
6 SASI_Rn02_00388662 predicted 3479
7 SASI_Rn02_00388663 predicted 3565
8 SASI_Rn02_00388664 predicted 2685
9 SASI_Rn02_00388665 predicted 1227
10 SASI_Rn02_00388666 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244379 predicted 530
2 SASI_Mm01_00244380 predicted 2011
3 SASI_Mm01_00244381 predicted 1042
4 SASI_Mm01_00244383 predicted 1219
5 SASI_Mm01_00244384 predicted 1717
6 SASI_Mm01_00244385 predicted 2471
7 SASI_Mm01_00244387 predicted 373
8 SASI_Mm02_00355565 predicted 3569
9 SASI_Mm02_00355566 predicted 2533
10 SASI_Mm01_00244388 predicted 1073
11 SASI_Mm01_00244382 predicted 1051
12 SASI_Mm01_00244386 predicted 2566
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432644 predicted 525
2 SASI_Mm02_00432645 predicted 2016
3 SASI_Mm02_00432646 predicted 1040
4 SASI_Mm02_00432647 predicted 1224
5 SASI_Mm02_00432648 predicted 1724
6 SASI_Mm02_00432649 predicted 2470
7 SASI_Mm02_00432650 predicted 379
8 SASI_Mm02_00432651 predicted 3566
9 SASI_Mm02_00432652 predicted 2532
10 SASI_Mm02_00432653 predicted 1071
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178559
ABCB5 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-1415s21c1
Sequence:CCGGATTCCATGATATTCGTCATTTCTCGAGAAATGACGAATATCATGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-2020s21c1
Sequence:CCGGTTTCGATTTGGAGCCTATTTACTCGAGTAAATAGGCTCCAAATCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-1640s21c1
Sequence:CCGGGTTCCAGGATTGGCGTCTTAACTCGAGTTAAGACGCCAATCCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-1679s21c1
Sequence:CCGGTGGGACTTTCAGTTATCATTTCTCGAGAAATGATAACTGAAAGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-2755s21c1
Sequence:CCGGGCCACTTCAGCCCTCGATAATCTCGAGATTATCGAGGGCTGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-503s1c1
Sequence:CCGGGCGGCATTATCGAGACCATATCTCGAGATATGGTCTCGATAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-2255s1c1
Sequence:CCGGGCGAGGAAAGACAGTAGCATTCTCGAGAATGCTACTGTCTTTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-1126s1c1
Sequence:CCGGCCACCCAATCTAAAGAGATAACTCGAGTTATCTCTTTAGATTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-1749s1c1
Sequence:CCGGGCTGGAAAGATAGCAACTGAACTCGAGTTCAGTTGCTATCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-1864s1c1
Sequence:CCGGCCTCGAAGAAAGCACAGATTACTCGAGTAATCTGTGCTTTCTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178559
ABCB5 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-1415s21c1
Sequence:CCGGATTCCATGATATTCGTCATTTCTCGAGAAATGACGAATATCATGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-2020s21c1
Sequence:CCGGTTTCGATTTGGAGCCTATTTACTCGAGTAAATAGGCTCCAAATCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-1640s21c1
Sequence:CCGGGTTCCAGGATTGGCGTCTTAACTCGAGTTAAGACGCCAATCCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-1679s21c1
Sequence:CCGGTGGGACTTTCAGTTATCATTTCTCGAGAAATGATAACTGAAAGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-2755s21c1
Sequence:CCGGGCCACTTCAGCCCTCGATAATCTCGAGATTATCGAGGGCTGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-503s1c1
Sequence:CCGGGCGGCATTATCGAGACCATATCTCGAGATATGGTCTCGATAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-2255s1c1
Sequence:CCGGGCGAGGAAAGACAGTAGCATTCTCGAGAATGCTACTGTCTTTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-1126s1c1
Sequence:CCGGCCACCCAATCTAAAGAGATAACTCGAGTTATCTCTTTAGATTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-1749s1c1
Sequence:CCGGGCTGGAAAGATAGCAACTGAACTCGAGTTCAGTTGCTATCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-1864s1c1
Sequence:CCGGCCTCGAAGAAAGCACAGATTACTCGAGTAATCTGTGCTTTCTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178559
ABCB5 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-1415s21c1
Sequence:CCGGATTCCATGATATTCGTCATTTCTCGAGAAATGACGAATATCATGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-2020s21c1
Sequence:CCGGTTTCGATTTGGAGCCTATTTACTCGAGTAAATAGGCTCCAAATCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-1640s21c1
Sequence:CCGGGTTCCAGGATTGGCGTCTTAACTCGAGTTAAGACGCCAATCCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-1679s21c1
Sequence:CCGGTGGGACTTTCAGTTATCATTTCTCGAGAAATGATAACTGAAAGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178559.5-2755s21c1
Sequence:CCGGGCCACTTCAGCCCTCGATAATCTCGAGATTATCGAGGGCTGAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-503s1c1
Sequence:CCGGGCGGCATTATCGAGACCATATCTCGAGATATGGTCTCGATAATGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-2255s1c1
Sequence:CCGGGCGAGGAAAGACAGTAGCATTCTCGAGAATGCTACTGTCTTTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-1126s1c1
Sequence:CCGGCCACCCAATCTAAAGAGATAACTCGAGTTATCTCTTTAGATTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-1749s1c1
Sequence:CCGGGCTGGAAAGATAGCAACTGAACTCGAGTTCAGTTGCTATCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178559.3-1864s1c1
Sequence:CCGGCCTCGAAGAAAGCACAGATTACTCGAGTAATCTGTGCTTTCTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029961
ABCB5 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-359s21c1
Sequence:CCGGTCATTGTGTTGACTCTATATTCTCGAGAATATAGAGTCAACACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-1006s21c1
Sequence:CCGGGGTTACACCATCGGAACTATTCTCGAGAATAGTTCCGATGGTGTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-282s21c1
Sequence:CCGGTAATGGATGCCTAGTACAAACCTCGAGGTTTGTACTAGGCATCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-1139s21c1
Sequence:CCGGTTGATAAGAAACCCAATATAGCTCGAGCTATATTGGGTTTCTTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-2860s21c1
Sequence:CCGGTTCCGATTTGGAGCCTATTTGCTCGAGCAAATAGGCTCCAAATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029961
ABCB5 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-359s21c1
Sequence:CCGGTCATTGTGTTGACTCTATATTCTCGAGAATATAGAGTCAACACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-1006s21c1
Sequence:CCGGGGTTACACCATCGGAACTATTCTCGAGAATAGTTCCGATGGTGTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-282s21c1
Sequence:CCGGTAATGGATGCCTAGTACAAACCTCGAGGTTTGTACTAGGCATCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-1139s21c1
Sequence:CCGGTTGATAAGAAACCCAATATAGCTCGAGCTATATTGGGTTTCTTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-2860s21c1
Sequence:CCGGTTCCGATTTGGAGCCTATTTGCTCGAGCAAATAGGCTCCAAATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029961
ABCB5 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-359s21c1
Sequence:CCGGTCATTGTGTTGACTCTATATTCTCGAGAATATAGAGTCAACACAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-1006s21c1
Sequence:CCGGGGTTACACCATCGGAACTATTCTCGAGAATAGTTCCGATGGTGTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-282s21c1
Sequence:CCGGTAATGGATGCCTAGTACAAACCTCGAGGTTTGTACTAGGCATCCATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-1139s21c1
Sequence:CCGGTTGATAAGAAACCCAATATAGCTCGAGCTATATTGGGTTTCTTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029961.1-2860s21c1
Sequence:CCGGTTCCGATTTGGAGCCTATTTGCTCGAGCAAATAGGCTCCAAATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks