EMAIL THIS PAGE TO A FRIEND

ABCB6

ATP-binding cassette, sub-family B (MDR/TAP), member 6

53 Gene Product Result for
Synonyms: ABC ABC14 DUH3 LAN MCOPCB7 MTABC3 PRP umat
Gene ID:
Human(10058) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This half-transporter likely plays a role in mitochondrial function. Localized to 2q26, this gene is considered a candidate gene for lethal neonatal metabolic syndrome, a disorder of mitochondrial function. [provided by RefSeq, Jul 2008]
Mouse(74104) ATP-binding cassette, sub-family B (MDR/TAP), member 6
Rat(140669) ATP-binding cassette, subfamily B (MDR/TAP), member 6
chicken(425721) ATP-binding cassette, sub-family B (MDR/TAP), member 6
cow(783257) ATP-binding cassette, sub-family B (MDR/TAP), member 6
Horse(100059171) ATP-binding cassette, sub-family B (MDR/TAP), member 6
domestic cat(101094528) ATP-binding cassette, sub-family B (MDR/TAP), member 6
naked mole-rat(101723206) ATP-binding cassette, sub-family B (MDR/TAP), member 6
domestic guinea pig(100722513) ATP-binding cassette, sub-family B (MDR/TAP), member 6
Goat(100861157) ATP-binding cassette, sub-family B (MDR/TAP), member 6
sheep(101115097) ATP-binding cassette, sub-family B (MDR/TAP), member 6
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005689 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005689 Rosetta Predictions human pricing
NM_080582 Rosetta Predictions rat pricing
NM_023732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054262 predicted 2174
2 SASI_Hs01_00054263 predicted 1676
3 SASI_Hs01_00054264 predicted 1101
4 SASI_Hs01_00054265 predicted 1133
5 SASI_Hs01_00054266 predicted 1578
6 SASI_Hs01_00054267 predicted 2393
7 SASI_Hs01_00054268 predicted 289
8 SASI_Hs02_00340085 predicted 1935
9 SASI_Hs01_00054270 predicted 2506
10 SASI_Hs01_00054271 predicted 807
11 SASI_Hs01_00054269 predicted 1863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121705 predicted 1454
2 SASI_Rn01_00121706 predicted 1808
3 SASI_Rn02_00267254 predicted 1662
4 SASI_Rn01_00121707 predicted 783
5 SASI_Rn01_00121708 predicted 1466
6 SASI_Rn01_00121709 predicted 2518
7 SASI_Rn01_00121710 predicted 1753
8 SASI_Rn01_00121711 predicted 1838
9 SASI_Rn01_00121712 predicted 2513
10 SASI_Rn01_00121713 predicted 616
11 SASI_Rn01_00121714 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059220 predicted 1756
2 SASI_Mm01_00059222 predicted 1824
3 SASI_Mm01_00059224 predicted 1479
4 SASI_Mm01_00059225 predicted 1029
5 SASI_Mm01_00059226 predicted 980
6 SASI_Mm01_00059227 predicted 1817
7 SASI_Mm01_00059228 predicted 1287
8 SASI_Mm02_00327309 predicted 2425
9 SASI_Mm01_00059229 predicted 2434
10 SASI_Mm02_00327310 predicted 623
11 SASI_Mm01_00059221 predicted 1470
12 SASI_Mm01_00059223 predicted 949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005689
VALIDATED
ABCB6 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005689.1-1713s1c1
Sequence:CCGGCCATCATCAAATATCAGGGTTCTCGAGAACCCTGATATTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005689.1-1109s1c1
Sequence:CCGGCTCAATGTGTTGGTGCCTATACTCGAGTATAGGCACCAACACATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005689.1-1581s1c1
Sequence:CCGGGAACCAAGTTTCGTCGTGCTACTCGAGTAGCACGACGAAACTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005689.1-914s1c1
Sequence:CCGGTCCTATACATTGCAGGTTCATCTCGAGATGAACCTGCAATGTATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005689.1-2027s1c1
Sequence:CCGGCGCTTTCAGAAGGGCCGTATTCTCGAGAATACGGCCCTTCTGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005689.1-2814s21c1
Sequence:CCGGTTGGCCACTTCCCTCTCAAAGCTCGAGCTTTGAGAGGGAAGTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005689.1-1581s21c1
Sequence:CCGGGAACCAAGTTTCGTCGTGCTACTCGAGTAGCACGACGAAACTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005689.1-1528s21c1
Sequence:CCGGGTTCCTGTGCATGAGTCTTTACTCGAGTAAAGACTCATGCACAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005689.1-2308s21c1
Sequence:CCGGTGACACCATCGCCGACAATATCTCGAGATATTGTCGGCGATGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005689
VALIDATED
ABCB6 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005689.1-1713s1c1
Sequence:CCGGCCATCATCAAATATCAGGGTTCTCGAGAACCCTGATATTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005689.1-1109s1c1
Sequence:CCGGCTCAATGTGTTGGTGCCTATACTCGAGTATAGGCACCAACACATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005689.1-1581s1c1
Sequence:CCGGGAACCAAGTTTCGTCGTGCTACTCGAGTAGCACGACGAAACTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005689.1-914s1c1
Sequence:CCGGTCCTATACATTGCAGGTTCATCTCGAGATGAACCTGCAATGTATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005689.1-2027s1c1
Sequence:CCGGCGCTTTCAGAAGGGCCGTATTCTCGAGAATACGGCCCTTCTGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005689.1-2814s21c1
Sequence:CCGGTTGGCCACTTCCCTCTCAAAGCTCGAGCTTTGAGAGGGAAGTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005689.1-1581s21c1
Sequence:CCGGGAACCAAGTTTCGTCGTGCTACTCGAGTAGCACGACGAAACTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005689.1-1528s21c1
Sequence:CCGGGTTCCTGTGCATGAGTCTTTACTCGAGTAAAGACTCATGCACAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005689.1-2308s21c1
Sequence:CCGGTGACACCATCGCCGACAATATCTCGAGATATTGTCGGCGATGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005689
VALIDATED
ABCB6 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005689.1-1713s1c1
Sequence:CCGGCCATCATCAAATATCAGGGTTCTCGAGAACCCTGATATTTGATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005689.1-1109s1c1
Sequence:CCGGCTCAATGTGTTGGTGCCTATACTCGAGTATAGGCACCAACACATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005689.1-1581s1c1
Sequence:CCGGGAACCAAGTTTCGTCGTGCTACTCGAGTAGCACGACGAAACTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005689.1-914s1c1
Sequence:CCGGTCCTATACATTGCAGGTTCATCTCGAGATGAACCTGCAATGTATAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005689.1-2027s1c1
Sequence:CCGGCGCTTTCAGAAGGGCCGTATTCTCGAGAATACGGCCCTTCTGAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296523    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005689.1-2814s21c1
Sequence:CCGGTTGGCCACTTCCCTCTCAAAGCTCGAGCTTTGAGAGGGAAGTGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005689.1-1581s21c1
Sequence:CCGGGAACCAAGTTTCGTCGTGCTACTCGAGTAGCACGACGAAACTTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005689.1-1528s21c1
Sequence:CCGGGTTCCTGTGCATGAGTCTTTACTCGAGTAAAGACTCATGCACAGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005689.1-2308s21c1
Sequence:CCGGTGACACCATCGCCGACAATATCTCGAGATATTGTCGGCGATGGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023732
VALIDATED
ABCB6 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023732.2-2760s1c1
Sequence:CCGGCCTTCATTTCATCCTGGTGTACTCGAGTACACCAGGATGAAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023732.2-2065s1c1
Sequence:CCGGCGCCTGCTATTTCGCTTCTATCTCGAGATAGAAGCGAAATAGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023732.2-1539s1c1
Sequence:CCGGCAACTTTGAAACGGTGAAATACTCGAGTATTTCACCGTTTCAAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023732.2-1536s1c1
Sequence:CCGGGCTCAACTTTGAAACGGTGAACTCGAGTTCACCGTTTCAAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023732.2-1827s1c1
Sequence:CCGGCCAGACTAACTTCATTGACATCTCGAGATGTCAATGAAGTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023732.2-2065s21c1
Sequence:CCGGCGCCTGCTATTTCGCTTCTATCTCGAGATAGAAGCGAAATAGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023732.2-1827s21c1
Sequence:CCGGCCAGACTAACTTCATTGACATCTCGAGATGTCAATGAAGTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023732.2-2760s21c1
Sequence:CCGGCCTTCATTTCATCCTGGTGTACTCGAGTACACCAGGATGAAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023732.2-1536s21c1
Sequence:CCGGGCTCAACTTTGAAACGGTGAACTCGAGTTCACCGTTTCAAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023732
VALIDATED
ABCB6 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023732.2-2760s1c1
Sequence:CCGGCCTTCATTTCATCCTGGTGTACTCGAGTACACCAGGATGAAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023732.2-2065s1c1
Sequence:CCGGCGCCTGCTATTTCGCTTCTATCTCGAGATAGAAGCGAAATAGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023732.2-1539s1c1
Sequence:CCGGCAACTTTGAAACGGTGAAATACTCGAGTATTTCACCGTTTCAAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023732.2-1536s1c1
Sequence:CCGGGCTCAACTTTGAAACGGTGAACTCGAGTTCACCGTTTCAAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023732.2-1827s1c1
Sequence:CCGGCCAGACTAACTTCATTGACATCTCGAGATGTCAATGAAGTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023732.2-2065s21c1
Sequence:CCGGCGCCTGCTATTTCGCTTCTATCTCGAGATAGAAGCGAAATAGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023732.2-1827s21c1
Sequence:CCGGCCAGACTAACTTCATTGACATCTCGAGATGTCAATGAAGTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023732.2-2760s21c1
Sequence:CCGGCCTTCATTTCATCCTGGTGTACTCGAGTACACCAGGATGAAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023732.2-1536s21c1
Sequence:CCGGGCTCAACTTTGAAACGGTGAACTCGAGTTCACCGTTTCAAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023732
VALIDATED
ABCB6 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023732.2-2760s1c1
Sequence:CCGGCCTTCATTTCATCCTGGTGTACTCGAGTACACCAGGATGAAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023732.2-2065s1c1
Sequence:CCGGCGCCTGCTATTTCGCTTCTATCTCGAGATAGAAGCGAAATAGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023732.2-1539s1c1
Sequence:CCGGCAACTTTGAAACGGTGAAATACTCGAGTATTTCACCGTTTCAAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023732.2-1536s1c1
Sequence:CCGGGCTCAACTTTGAAACGGTGAACTCGAGTTCACCGTTTCAAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023732.2-1827s1c1
Sequence:CCGGCCAGACTAACTTCATTGACATCTCGAGATGTCAATGAAGTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023732.2-2065s21c1
Sequence:CCGGCGCCTGCTATTTCGCTTCTATCTCGAGATAGAAGCGAAATAGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023732.2-1827s21c1
Sequence:CCGGCCAGACTAACTTCATTGACATCTCGAGATGTCAATGAAGTTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023732.2-2760s21c1
Sequence:CCGGCCTTCATTTCATCCTGGTGTACTCGAGTACACCAGGATGAAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023732.2-1536s21c1
Sequence:CCGGGCTCAACTTTGAAACGGTGAACTCGAGTTCACCGTTTCAAAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks