EMAIL THIS PAGE TO A FRIEND

ABCB7

ATP-binding cassette, sub-family B (MDR/TAP), member 7

49 Gene Product Result for
Synonyms: ABC7 ASAT Atm1p EST140535
Gene ID:
Human(22) Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a half-transporter involved in the transport of heme from the mitochondria to the cytosol. With iron/sulfur cluster precursors as its substrates, this protein may play a role in metal homeostasis. Mutations in this gene have been associated with mitochondrial iron accumulation and isodicentric (X)(q13) and sideroblastic anemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
Mouse(11306) ATP-binding cassette, sub-family B (MDR/TAP), member 7
Rat(302395) ATP-binding cassette, subfamily B (MDR/TAP), member 7
Zebrafish(566515) ATP-binding cassette, sub-family B (MDR/TAP), member 7
cow(533669) ATP-binding cassette, sub-family B (MDR/TAP), member 7
Horse(100060544) ATP-binding cassette, sub-family B (MDR/TAP), member 7
domestic cat(101082805) ATP-binding cassette, sub-family B (MDR/TAP), member 7
dog(491967) ATP-binding cassette, sub-family B (MDR/TAP), member 7
fruit fly(38193) CG7955 gene product from transcript CG7955-RA
chicken(422326) ATP-binding cassette, sub-family B (MDR/TAP), member 7
sheep(101113989) ATP-binding cassette, sub-family B (MDR/TAP), member 7
Domestic Rabbit(100351866) ATP-binding cassette, sub-family B (MDR/TAP), member 7
domestic guinea pig(100724759) ATP-binding cassette, sub-family B (MDR/TAP), member 7
naked mole-rat(101721701) ATP-binding cassette, sub-family B (MDR/TAP), member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004299 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009592 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009592 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009592 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004299 Rosetta Predictions human pricing
NM_212518 Rosetta Predictions rat pricing
NM_009592 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016426 predicted 1484
2 SASI_Hs02_00337317 predicted 1476
3 SASI_Hs01_00016427 predicted 1562
4 SASI_Hs01_00016429 predicted 764
5 SASI_Hs01_00016430 predicted 1010
6 SASI_Hs01_00016431 predicted 1877
7 SASI_Hs01_00016432 predicted 2016
8 SASI_Hs01_00016433 predicted 999
9 SASI_Hs01_00016435 predicted 1321
10 SASI_Hs02_00337318 predicted 2099
11 SASI_Hs01_00016428 predicted 247
12 SASI_Hs01_00016434 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108794 predicted 2088
2 SASI_Rn02_00270530 predicted 528
3 SASI_Rn01_00108795 predicted 1363
4 SASI_Rn02_00270531 predicted 440
5 SASI_Rn01_00108797 predicted 1686
6 SASI_Rn01_00108798 predicted 342
7 SASI_Rn01_00108799 predicted 1781
8 SASI_Rn01_00108800 predicted 1346
9 SASI_Rn01_00108801 predicted 1543
10 SASI_Rn01_00108802 predicted 1917
11 SASI_Rn01_00108796 predicted 828
12 SASI_Rn01_00108803 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009592 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316497 predicted 1371
2 SASI_Mm02_00316498 predicted 1748
3 SASI_Mm02_00316499 predicted 1361
4 SASI_Mm02_00316500 predicted 1837
5 SASI_Mm02_00316501 predicted 346
6 SASI_Mm02_00316502 predicted 988
7 SASI_Mm02_00316503 predicted 1788
8 SASI_Mm02_00316504 predicted 1103
9 SASI_Mm02_00316505 predicted 1556
10 SASI_Mm02_00316506 predicted 1873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004299
VALIDATED
ABCB7 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-1611s21c1
Sequence:CCGGGCATTTATCTTGCTGGTCAAACTCGAGTTTGACCAGCAAGATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-1976s21c1
Sequence:CCGGGCCATGAAGGATGTGGTCAAACTCGAGTTTGACCACATCCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-2117s21c1
Sequence:CCGGCCTCATAGTATCTATTCAGAACTCGAGTTCTGAATAGATACTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-1001s21c1
Sequence:CCGGGCAGATAATGATGCAGGTAATCTCGAGATTACCTGCATCATTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-1085s21c1
Sequence:CCGGGCACAGAGATATGATGGATTTCTCGAGAAATCCATCATATCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004299.3-2117s1c1
Sequence:CCGGCCTCATAGTATCTATTCAGAACTCGAGTTCTGAATAGATACTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004299.3-1611s1c1
Sequence:CCGGGCATTTATCTTGCTGGTCAAACTCGAGTTTGACCAGCAAGATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004299.3-1976s1c1
Sequence:CCGGGCCATGAAGGATGTGGTCAAACTCGAGTTTGACCACATCCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004299.3-1085s1c1
Sequence:CCGGGCACAGAGATATGATGGATTTCTCGAGAAATCCATCATATCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004299
VALIDATED
ABCB7 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-1611s21c1
Sequence:CCGGGCATTTATCTTGCTGGTCAAACTCGAGTTTGACCAGCAAGATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-1976s21c1
Sequence:CCGGGCCATGAAGGATGTGGTCAAACTCGAGTTTGACCACATCCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-2117s21c1
Sequence:CCGGCCTCATAGTATCTATTCAGAACTCGAGTTCTGAATAGATACTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-1001s21c1
Sequence:CCGGGCAGATAATGATGCAGGTAATCTCGAGATTACCTGCATCATTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-1085s21c1
Sequence:CCGGGCACAGAGATATGATGGATTTCTCGAGAAATCCATCATATCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004299.3-2117s1c1
Sequence:CCGGCCTCATAGTATCTATTCAGAACTCGAGTTCTGAATAGATACTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004299.3-1611s1c1
Sequence:CCGGGCATTTATCTTGCTGGTCAAACTCGAGTTTGACCAGCAAGATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004299.3-1976s1c1
Sequence:CCGGGCCATGAAGGATGTGGTCAAACTCGAGTTTGACCACATCCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004299.3-1085s1c1
Sequence:CCGGGCACAGAGATATGATGGATTTCTCGAGAAATCCATCATATCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004299
VALIDATED
ABCB7 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-1611s21c1
Sequence:CCGGGCATTTATCTTGCTGGTCAAACTCGAGTTTGACCAGCAAGATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-1976s21c1
Sequence:CCGGGCCATGAAGGATGTGGTCAAACTCGAGTTTGACCACATCCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-2117s21c1
Sequence:CCGGCCTCATAGTATCTATTCAGAACTCGAGTTCTGAATAGATACTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-1001s21c1
Sequence:CCGGGCAGATAATGATGCAGGTAATCTCGAGATTACCTGCATCATTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004299.3-1085s21c1
Sequence:CCGGGCACAGAGATATGATGGATTTCTCGAGAAATCCATCATATCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004299.3-2117s1c1
Sequence:CCGGCCTCATAGTATCTATTCAGAACTCGAGTTCTGAATAGATACTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004299.3-1611s1c1
Sequence:CCGGGCATTTATCTTGCTGGTCAAACTCGAGTTTGACCAGCAAGATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004299.3-1976s1c1
Sequence:CCGGGCCATGAAGGATGTGGTCAAACTCGAGTTTGACCACATCCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004299.3-1085s1c1
Sequence:CCGGGCACAGAGATATGATGGATTTCTCGAGAAATCCATCATATCTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009592
ABCB7 MISSION shRNA Bacterial Glycerol Stock
ATP-binding cassette, sub-family B (MDR/TAP), member 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009592.1-1180s21c1
Sequence:CCGGTGTCGGATTAACAGCTATAATCTCGAGATTATAGCTGTTAATCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009592.1-810s21c1
Sequence:CCGGTCCTCAGTGCGTTAGTATTTACTCGAGTAAATACTAACGCACTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009592.1-2392s21c1
Sequence:CCGGCCATTCCTTTAATCCTATTAACTCGAGTTAATAGGATTAAAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009592.1-2106s21c1
Sequence:CCGGCTAACTCTAGCAGTATCTATTCTCGAGAATAGATACTGCTAGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009592.1-1366s21c1
Sequence:CCGGCAAGGTAGACACACGGATTAACTCGAGTTAATCCGTGTGTCTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009592
ABCB7 MISSION shRNA shRNA Plasmid DNA
ATP-binding cassette, sub-family B (MDR/TAP), member 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009592.1-1180s21c1
Sequence:CCGGTGTCGGATTAACAGCTATAATCTCGAGATTATAGCTGTTAATCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009592.1-810s21c1
Sequence:CCGGTCCTCAGTGCGTTAGTATTTACTCGAGTAAATACTAACGCACTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009592.1-2392s21c1
Sequence:CCGGCCATTCCTTTAATCCTATTAACTCGAGTTAATAGGATTAAAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009592.1-2106s21c1
Sequence:CCGGCTAACTCTAGCAGTATCTATTCTCGAGAATAGATACTGCTAGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009592.1-1366s21c1
Sequence:CCGGCAAGGTAGACACACGGATTAACTCGAGTTAATCCGTGTGTCTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009592
ABCB7 MISSION shRNA Lentiviral Transduction Particles
ATP-binding cassette, sub-family B (MDR/TAP), member 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009592.1-1180s21c1
Sequence:CCGGTGTCGGATTAACAGCTATAATCTCGAGATTATAGCTGTTAATCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009592.1-810s21c1
Sequence:CCGGTCCTCAGTGCGTTAGTATTTACTCGAGTAAATACTAACGCACTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240517    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009592.1-2392s21c1
Sequence:CCGGCCATTCCTTTAATCCTATTAACTCGAGTTAATAGGATTAAAGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009592.1-2106s21c1
Sequence:CCGGCTAACTCTAGCAGTATCTATTCTCGAGAATAGATACTGCTAGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009592.1-1366s21c1
Sequence:CCGGCAAGGTAGACACACGGATTAACTCGAGTTAATCCGTGTGTCTACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks